Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000007

Orthogroup ID

OG0007563

Physical Location & Seq

Genomic Coordinates Forward (+)

53234192 .. 53242487

Gene Structure 8296 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_7G00204140.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 483 bp

ATGGCAGAAGAGCATGGGAAGGTCGGAGACCAAAGCTTGAGGAATTTGATTACGCACCGCACTGCCATCCCAACAGCAGAAACATCAAAAGCAATAGCCCTAGCTACGACCACCACCATACACCACCAAAACCAACCAAGACCCATCGGGATCAGTCATACTCCAACGAGGTATAAAGCCTTCATCGGCGTTGCGGTTAGACCTGTCAATGGATTGGATTTTGATCCGGATCTGTTTGATAAAATTGAAGAGAAATACACCAAGCCGGACCATGTGCCTCCTCCTTTGCACGCTCCTCGACCACATGCTCGAAACCTGCACACTATTGTAGGGAGGTTAGAGAACAGAGAGAAGCACAAACTCGGCATCTCCGGTGATGGCACGTATGGCATCACCCTATGTCGGGTTGCCGGCGAAGATTCAAGACCTCGACAATCGGCTCGTGCTAAAGGCGCTGGTGACGGCGGTGAGCTGAAGAAATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

160

Amino Acids

17.51

Weight (kDa)

9.62

Isoelectric Point (pI)

29.8

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007563)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0026455.1_g000001
rosa_roxburghii	Rroxscaffold_1G00027410 Rroxscaffold_1G00051460 Rroxscaffold_1G00062000 Rroxscaffold_2G00120690 Rroxscaffold_3G00226520 Rroxscaffold_3G00230550 Rroxscaffold_3G00232600 Rroxscaffold_3G00234920 Rroxscaffold_3G00238650 Rroxscaffold_3G00270030 Rroxscaffold_4G00286650 Rroxscaffold_4G00319170 Rroxscaffold_4G00323840 Rroxscaffold_5G00332770 Rroxscaffold_5G00338140 Rroxscaffold_6G00390570 Rroxscaffold_6G00391340 Rroxscaffold_6G00391910 Rroxscaffold_6G00391920 Rroxscaffold_6G00391930 Rroxscaffold_7G00159020 Rroxscaffold_7G00199420 Rroxscaffold_7G00204140
rosa_samantha	Rh5BG194200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	324
AccIII	TCCGGA	1 cut(s)	226
AciI	CCGC	3 cut(s)	58, 194, 465
AclWI	GGATC	3 cut(s)	158, 218, 237
AcsI	RAATTY	1 cut(s)	43
AfiI	CCNNNNNNNGG	3 cut(s)	209, 402, 403
AgsI	TTSAA	2 cut(s)	248, 423
AluBI	AGCT	3 cut(s)	36, 104, 472
AluI	AGCT	3 cut(s)	36, 104, 472
Alw26I	GTCTC	1 cut(s)	21
AlwI	GGATC	3 cut(s)	158, 218, 237
Aor13HI	TCCGGA	1 cut(s)	226
ApoI	RAATTY	1 cut(s)	43
AspLEI	GCGC	1 cut(s)	455
AspS9I	GGNCC	1 cut(s)	268
AsuHPI	GGTGA	4 cut(s)	385, 386, 470, 479
AvaII	GGWCC	1 cut(s)	268
BarI	GAAGNNNNNNTAC	2 cut(s)	164, 196
BauI	CACGAG	1 cut(s)	441
BccI	CCATC	3 cut(s)	74, 152, 371
BceAI	ACGGC	1 cut(s)	478
BcgI	CGANNNNNNTGC	2 cut(s)	278, 312
BcoDI	GTCTC	1 cut(s)	21
BfaI	CTAG	1 cut(s)	101
BfoI	RGCGCY	1 cut(s)	456
BfuAI	ACCTGC	1 cut(s)	324
Bme18I	GGWCC	1 cut(s)	268
BmgT120I	GGNCC	1 cut(s)	268
BmsI	GCATC	2 cut(s)	375, 399
BpuEI	CTTGAG	1 cut(s)	58
BsaAI	YACGTR	1 cut(s)	384
BsaBI	GATNNNNATC	2 cut(s)	222, 228
BsaI	GGTCTC	1 cut(s)	21
BsaWI	WCCGGW	2 cut(s)	226, 371
Bsc4I	CCNNNNNNNGG	3 cut(s)	209, 402, 403
Bse118I	RCCGGY	1 cut(s)	410
Bse8I	GATNNNNATC	2 cut(s)	222, 228
BseAI	TCCGGA	1 cut(s)	226
BseGI	GGATG	1 cut(s)	66
BseJI	GATNNNNATC	2 cut(s)	222, 228
BseLI	CCNNNNNNNGG	3 cut(s)	209, 402, 403
BseRI	GAGGAG	2 cut(s)	270, 285
BsgI	GTGCAG	1 cut(s)	302
BsiSI	CCGG	4 cut(s)	227, 266, 372, 411
BslI	CCNNNNNNNGG	3 cut(s)	209, 402, 403
BsmAI	GTCTC	1 cut(s)	21
Bso31I	GGTCTC	1 cut(s)	21
Bsp13I	TCCGGA	1 cut(s)	226
Bsp143I	GATC	3 cut(s)	150, 223, 229
BspACI	CCGC	3 cut(s)	58, 194, 465
BspEI	TCCGGA	1 cut(s)	226
BspMI	ACCTGC	1 cut(s)	324
BspPI	GGATC	3 cut(s)	158, 218, 237
BspQI	GCTCTTC	1 cut(s)	3
BspTNI	GGTCTC	1 cut(s)	21
BsrFI	RCCGGY	1 cut(s)	410
BssAI	RCCGGY	1 cut(s)	410
BssMI	GATC	3 cut(s)	150, 223, 229
BssSI	CACGAG	1 cut(s)	441
Bst2BI	CACGAG	1 cut(s)	441
Bst6I	CTCTTC	2 cut(s)	3, 243
BstBAI	YACGTR	1 cut(s)	384
BstC8I	GCNNGC	2 cut(s)	291, 412
BstF5I	GGATG	1 cut(s)	66
BstH2I	RGCGCY	1 cut(s)	456
BstHHI	GCGC	1 cut(s)	455
BstKTI	GATC	3 cut(s)	153, 226, 232
BstMAI	GTCTC	1 cut(s)	21
BstMBI	GATC	3 cut(s)	150, 223, 229
BstMWI	GCNNNNNNNGC	2 cut(s)	387, 452
BstNSI	RCATGY	1 cut(s)	308
BstX2I	RGATCY	1 cut(s)	229
BstYI	RGATCY	1 cut(s)	229
BtsCI	GGATG	1 cut(s)	66
BtsI	GCAGTG	1 cut(s)	60
BtsIMutI	CAGTG	1 cut(s)	60
BveI	ACCTGC	1 cut(s)	324
Cac8I	GCNNGC	2 cut(s)	291, 412
CfoI	GCGC	1 cut(s)	455
Cfr10I	RCCGGY	1 cut(s)	410
Cfr13I	GGNCC	1 cut(s)	268
CviAII	CATG	3 cut(s)	14, 272, 305
CviJI	RGCY	7 cut(s)	36, 98, 104, 179, 265, 440, 472
CviKI_1	RGCY	7 cut(s)	36, 98, 104, 179, 265, 440, 472
DpnI	GATC	3 cut(s)	152, 225, 231
DpnII	GATC	3 cut(s)	150, 223, 229
Eam1104I	CTCTTC	2 cut(s)	3, 243
EarI	CTCTTC	2 cut(s)	3, 243
Eco31I	GGTCTC	1 cut(s)	21
Eco47I	GGWCC	1 cut(s)	268
FaeI	CATG	3 cut(s)	17, 275, 308
FaiI	YATR	8 cut(s)	15, 119, 159, 174, 273, 306, 387, 400
FatI	CATG	3 cut(s)	13, 271, 304
FokI	GGATG	1 cut(s)	53
FspBI	CTAG	1 cut(s)	101
GlaI	GCGC	1 cut(s)	454
HaeII	RGCGCY	1 cut(s)	456
HapII	CCGG	4 cut(s)	227, 266, 372, 411
HhaI	GCGC	1 cut(s)	455
Hin1II	CATG	3 cut(s)	17, 275, 308
Hin6I	GCGC	1 cut(s)	453
HinP1I	GCGC	1 cut(s)	453
HindIII	AAGCTT	1 cut(s)	34
HinfI	GANTC	1 cut(s)	419
HpaII	CCGG	4 cut(s)	227, 266, 372, 411
HphI	GGTGA	4 cut(s)	385, 386, 470, 479
Hpy188I	TCNGA	1 cut(s)	26
Hpy188III	TCNNGA	3 cut(s)	148, 227, 423
HpyAV	CCTTC	2 cut(s)	13, 190
HpyCH4IV	ACGT	1 cut(s)	383
HpyCH4V	TGCA	2 cut(s)	289, 319
HpyF10VI	GCNNNNNNNGC	2 cut(s)	387, 452
HpySE526I	ACGT	1 cut(s)	383
Hsp92II	CATG	3 cut(s)	17, 275, 308
HspAI	GCGC	1 cut(s)	453
Kpn2I	TCCGGA	1 cut(s)	226
KroI	GCCGGC	1 cut(s)	410
KroNI	GCCGGC	1 cut(s)	412
Kzo9I	GATC	3 cut(s)	150, 223, 229
LguI	GCTCTTC	1 cut(s)	3
LmnI	GCTCC	1 cut(s)	298
LpnPI	CCDG	7 cut(s)	216, 240, 279, 329, 385, 424, 441
LweI	GCATC	2 cut(s)	375, 399
MaeI	CTAG	1 cut(s)	101
MaeII	ACGT	1 cut(s)	383
MaeIII	GTNAC	1 cut(s)	458
MalI	GATC	3 cut(s)	152, 225, 231
MboI	GATC	3 cut(s)	150, 223, 229
MboII	GAAGA	3 cut(s)	20, 260, 428
MflI	RGATCY	1 cut(s)	229
MluCI	AATT	2 cut(s)	43, 243
MmeI	TCCRAC	2 cut(s)	4, 188
MnlI	CCTC	7 cut(s)	33, 162, 288, 291, 306, 327, 438
MroI	TCCGGA	1 cut(s)	226
MroNI	GCCGGC	1 cut(s)	410
MspI	CCGG	4 cut(s)	227, 266, 372, 411
MwoI	GCNNNNNNNGC	2 cut(s)	387, 452
NaeI	GCCGGC	1 cut(s)	412
NdeII	GATC	3 cut(s)	150, 223, 229
NgoMIV	GCCGGC	1 cut(s)	410
NlaIII	CATG	3 cut(s)	17, 275, 308
NmeAIII	GCCGAG	1 cut(s)	342
NmuCI	GTSAC	1 cut(s)	458
NspI	RCATGY	1 cut(s)	308
PciSI	GCTCTTC	1 cut(s)	3
PdiI	GCCGGC	1 cut(s)	412
PfeI	GAWTC	1 cut(s)	419
Ppu21I	YACGTR	1 cut(s)	384
PspPI	GGNCC	1 cut(s)	268
PsuI	RGATCY	1 cut(s)	229
SapI	GCTCTTC	1 cut(s)	3
Sau3AI	GATC	3 cut(s)	150, 223, 229
Sau96I	GGNCC	1 cut(s)	268
SfaNI	GCATC	2 cut(s)	375, 399
SinI	GGWCC	1 cut(s)	268
SmlI	CTYRAG	1 cut(s)	37
SmoI	CTYRAG	1 cut(s)	37
Sse9I	AATT	2 cut(s)	43, 243
SsiI	CCGC	3 cut(s)	58, 194, 465
SspMI	CTAG	1 cut(s)	101
TaiI	ACGT	1 cut(s)	386
TaqI	TCGA	3 cut(s)	298, 310, 430
TasI	AATT	2 cut(s)	43, 243
TfiI	GAWTC	1 cut(s)	419
TscAI	CASTG	1 cut(s)	67
TseFI	GTSAC	1 cut(s)	458
Tsp45I	GTSAC	1 cut(s)	458
TspDTI	ATGAA	1 cut(s)	172
TspRI	CASTG	1 cut(s)	67
VpaK11BI	GGWCC	1 cut(s)	268
XapI	RAATTY	1 cut(s)	43
XceI	RCATGY	1 cut(s)	308
XspI	CTAG	1 cut(s)	101

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.