Rroxscaffold_4G00319170

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0007563
Physical Location & Seq
Reverse (-)
46704269 .. 46713460
9192 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00319170.1

Sequence Viewer

Length: 507 bp
ATGACAATCTTTATCCAGGCCTCCAAGTACATCCCTCCTCTAGTGGAGGCACCACTATTTCTAGAGCCACCGTTTGAATTTAAATCGGCGGGAATCGGTGCACTTCTTTTGGAAGCGGGCTTGGGGGAGACTAGGTTGGATGTAGATTCCTTGGTTGTTGGGCCTATGCGGGATAAACGGGCTGATGTTGATCTCTCTCCTACCGTGGTCCATGCACGAGGGATTGGAATGGATAAGGGGGTGGGCCCCACAGACCTCTTCGGATTTCGTGGTGAAATGCGGGCGGGTCTGTCACATGCATCCCATGCACGTAAAGGAAAGGTTGCTCGAACAGGTCTTGCGAGCTTCGACCGCCATGGTGTAGCTCGAGGTGGAAGAAGCACGCTGGTTGAGGAGTTGAAGGGCGTTGGAGATTGGTGTACGCACCGTTCGACGAGGATTGAGACAAGCTCCGAGTTCGACCATCAACTGCAGTCGCTTGTTGGGGTACTACATTTGCTTGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

168

Amino Acids

18.07

Weight (kDa)

7.07

Isoelectric Point (pI)

26.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 49
AciI CCGC 6 cut(s) 89, 116, 169, 280, 284, 352
AcsI RAATTY 1 cut(s) 77
AfaI GTAC 3 cut(s) 29, 421, 489
AgsI TTSAA 2 cut(s) 77, 400
AjnI CCWGG 1 cut(s) 15
AluBI AGCT 3 cut(s) 345, 365, 450
AluI AGCT 3 cut(s) 345, 365, 450
Alw21I GWGCWC 1 cut(s) 103
Alw26I GTCTC 2 cut(s) 122, 437
Alw44I GTGCAC 1 cut(s) 99
Ama87I CYCGRG 1 cut(s) 366
AoxI GGCC 3 cut(s) 18, 161, 244
ApaI GGGCCC 1 cut(s) 248
ApaLI GTGCAC 1 cut(s) 99
ApoI RAATTY 1 cut(s) 77
AspS9I GGNCC 4 cut(s) 161, 208, 244, 245
AsuHPI GGTGA 1 cut(s) 284
AvaI CYCGRG 1 cut(s) 366
AvaII GGWCC 1 cut(s) 208
BaeGI GKGCMC 2 cut(s) 103, 248
BanI GGYRCC 1 cut(s) 49
BanII GRGCYC 1 cut(s) 248
BauI CACGAG 1 cut(s) 216
Bbv12I GWGCWC 1 cut(s) 103
BccI CCATC 1 cut(s) 471
BciT130I CCWGG 1 cut(s) 17
BcoDI GTCTC 2 cut(s) 122, 437
BfaI CTAG 4 cut(s) 41, 62, 132, 505
BfmI CTRYAG 1 cut(s) 470
Bme1390I CCNGG 1 cut(s) 17
Bme18I GGWCC 1 cut(s) 208
BmeT110I CYCGRG 1 cut(s) 366
BmgT120I GGNCC 4 cut(s) 161, 208, 244, 245
BmiI GGNNCC 3 cut(s) 51, 246, 247
BmrFI CCNGG 1 cut(s) 17
BmsI GCATC 1 cut(s) 308
BplI GAGNNNNNCTC 2 cut(s) 434, 466
BsaAI YACGTR 1 cut(s) 311
BsaBI GATNNNNATC 1 cut(s) 189
BsaJI CCNNGG 3 cut(s) 150, 204, 355
BsaXI ACNNNNNCTCC 2 cut(s) 119, 149
Bse8I GATNNNNATC 1 cut(s) 189
BseBI CCWGG 1 cut(s) 17
BseDI CCNNGG 3 cut(s) 150, 204, 355
BseGI GGATG 3 cut(s) 30, 145, 299
BseJI GATNNNNATC 1 cut(s) 189
BseRI GAGGAG 2 cut(s) 27, 407
BseSI GKGCMC 2 cut(s) 103, 248
Bsh1285I CGRYCG 1 cut(s) 352
BshFI GGCC 3 cut(s) 20, 163, 246
BshNI GGYRCC 1 cut(s) 49
BsiEI CGRYCG 1 cut(s) 352
BsiHKAI GWGCWC 1 cut(s) 103
BsiHKCI CYCGRG 1 cut(s) 366
BsmAI GTCTC 2 cut(s) 122, 437
BsnI GGCC 3 cut(s) 20, 163, 246
BsoBI CYCGRG 1 cut(s) 366
Bsp120I GGGCCC 1 cut(s) 244
Bsp1286I GDGCHC 2 cut(s) 103, 248
Bsp143I GATC 1 cut(s) 190
Bsp19I CCATGG 1 cut(s) 355
BspACI CCGC 6 cut(s) 89, 116, 169, 280, 284, 352
BspANI GGCC 3 cut(s) 20, 163, 246
BspLI GGNNCC 3 cut(s) 51, 246, 247
BspMAI CTGCAG 1 cut(s) 474
BspT107I GGYRCC 1 cut(s) 49
BssECI CCNNGG 3 cut(s) 150, 204, 355
BssMI GATC 1 cut(s) 190
BssSI CACGAG 1 cut(s) 216
BssT1I CCWWGG 2 cut(s) 150, 355
Bst2BI CACGAG 1 cut(s) 216
Bst2UI CCWGG 1 cut(s) 17
Bst4CI ACNGT 3 cut(s) 72, 205, 428
Bst6I CTCTTC 1 cut(s) 263
BstAPI GCANNNNNTGC 1 cut(s) 305
BstBAI YACGTR 1 cut(s) 311
BstC8I GCNNGC 4 cut(s) 118, 282, 343, 383
BstDSI CCRYGG 2 cut(s) 204, 355
BstF5I GGATG 3 cut(s) 30, 145, 299
BstKTI GATC 1 cut(s) 193
BstMAI GTCTC 2 cut(s) 122, 437
BstMBI GATC 1 cut(s) 190
BstMCI CGRYCG 1 cut(s) 352
BstMWI GCNNNNNNNGC 2 cut(s) 305, 351
BstNI CCWGG 1 cut(s) 17
BstNSI RCATGY 1 cut(s) 299
BstSCI CCNGG 1 cut(s) 15
BstSFI CTRYAG 1 cut(s) 470
BstSLI GKGCMC 2 cut(s) 103, 248
BsuRI GGCC 3 cut(s) 20, 163, 246
BtgI CCRYGG 2 cut(s) 204, 355
BtsCI GGATG 3 cut(s) 30, 145, 299
Cac8I GCNNGC 4 cut(s) 118, 282, 343, 383
Cfr13I GGNCC 4 cut(s) 161, 208, 244, 245
Csp6I GTAC 3 cut(s) 28, 420, 488
CviAII CATG 4 cut(s) 212, 296, 305, 356
CviQI GTAC 3 cut(s) 28, 420, 488
DpnI GATC 1 cut(s) 192
DpnII GATC 1 cut(s) 190
DraI TTTAAA 1 cut(s) 82
Eam1104I CTCTTC 1 cut(s) 263
EarI CTCTTC 1 cut(s) 263
Eco130I CCWWGG 2 cut(s) 150, 355
Eco147I AGGCCT 1 cut(s) 20
Eco24I GRGCYC 1 cut(s) 248
Eco47I GGWCC 1 cut(s) 208
Eco88I CYCGRG 1 cut(s) 366
EcoO109I RGGNCCY 1 cut(s) 245
EcoRII CCWGG 1 cut(s) 15
EcoT14I CCWWGG 2 cut(s) 150, 355
EcoT22I ATGCAT 1 cut(s) 301
EcoT38I GRGCYC 1 cut(s) 248
ErhI CCWWGG 2 cut(s) 150, 355
FaeI CATG 4 cut(s) 215, 299, 308, 359
FaiI YATR 5 cut(s) 167, 213, 297, 306, 357
FatI CATG 4 cut(s) 211, 295, 304, 355
FauI CCCGC 5 cut(s) 82, 109, 162, 273, 277
FokI GGATG 3 cut(s) 17, 152, 286
FriOI GRGCYC 1 cut(s) 248
FspBI CTAG 4 cut(s) 41, 62, 132, 505
HaeIII GGCC 3 cut(s) 20, 163, 246
Hin1II CATG 4 cut(s) 215, 299, 308, 359
HinfI GANTC 2 cut(s) 93, 146
HphI GGTGA 1 cut(s) 284
Hpy166II GTNNAC 2 cut(s) 101, 420
Hpy188I TCNGA 2 cut(s) 263, 454
Hpy188III TCNNGA 1 cut(s) 62
Hpy8I GTNNAC 2 cut(s) 101, 420
Hpy99I CGWCG 1 cut(s) 436
HpyAV CCTTC 1 cut(s) 394
HpyCH4III ACNGT 3 cut(s) 72, 205, 428
HpyCH4IV ACGT 1 cut(s) 310
HpyCH4V TGCA 5 cut(s) 101, 215, 299, 308, 472
HpyF10VI GCNNNNNNNGC 2 cut(s) 305, 351
HpySE526I ACGT 1 cut(s) 310
Hsp92II CATG 4 cut(s) 215, 299, 308, 359
Kzo9I GATC 1 cut(s) 190
LmnI GCTCC 1 cut(s) 455
LpnPI CCDG 4 cut(s) 2, 29, 318, 371
LweI GCATC 1 cut(s) 308
MaeI CTAG 4 cut(s) 41, 62, 132, 505
MaeII ACGT 1 cut(s) 310
MaeIII GTNAC 1 cut(s) 291
MalI GATC 1 cut(s) 192
MboI GATC 1 cut(s) 190
MboII GAAGA 2 cut(s) 250, 387
MhlI GDGCHC 2 cut(s) 103, 248
MluCI AATT 1 cut(s) 77
MmeI TCCRAC 2 cut(s) 117, 388
MnlI CCTC 9 cut(s) 31, 40, 45, 48, 212, 266, 362, 385, 429
Mph1103I ATGCAT 1 cut(s) 301
MseI TTAA 1 cut(s) 81
MspR9I CCNGG 1 cut(s) 17
MvaI CCWGG 1 cut(s) 17
MwoI GCNNNNNNNGC 2 cut(s) 305, 351
NcoI CCATGG 1 cut(s) 355
NdeII GATC 1 cut(s) 190
NlaIII CATG 4 cut(s) 215, 299, 308, 359
NlaIV GGNNCC 3 cut(s) 51, 246, 247
NmuCI GTSAC 1 cut(s) 291
NsiI ATGCAT 1 cut(s) 301
NspI RCATGY 1 cut(s) 299
PaeR7I CTCGAG 1 cut(s) 366
PceI AGGCCT 1 cut(s) 20
PcsI WCGNNNNNNNCGW 1 cut(s) 428
PfeI GAWTC 2 cut(s) 93, 146
Ppu21I YACGTR 1 cut(s) 311
Psp6I CCWGG 1 cut(s) 15
PspGI CCWGG 1 cut(s) 15
PspN4I GGNNCC 3 cut(s) 51, 246, 247
PspOMI GGGCCC 1 cut(s) 244
PspPI GGNCC 4 cut(s) 161, 208, 244, 245
PspXI VCTCGAGB 1 cut(s) 366
PsrI GAACNNNNNNTAC 2 cut(s) 412, 444
PstI CTGCAG 1 cut(s) 474
RsaI GTAC 3 cut(s) 29, 421, 489
RsaNI GTAC 3 cut(s) 28, 420, 488
SaqAI TTAA 1 cut(s) 81
Sau3AI GATC 1 cut(s) 190
Sau96I GGNCC 4 cut(s) 161, 208, 244, 245
ScrFI CCNGG 1 cut(s) 17
SduI GDGCHC 2 cut(s) 103, 248
SetI ASST 9 cut(s) 137, 258, 313, 324, 337, 347, 367, 373, 452
SfaNI GCATC 1 cut(s) 308
SfcI CTRYAG 1 cut(s) 470
Sfr274I CTCGAG 1 cut(s) 366
SinI GGWCC 1 cut(s) 208
SlaI CTCGAG 1 cut(s) 366
SmiI ATTTAAAT 1 cut(s) 82
SmlI CTYRAG 1 cut(s) 366
SmoI CTYRAG 1 cut(s) 366
Sse9I AATT 1 cut(s) 77
SseBI AGGCCT 1 cut(s) 20
SsiI CCGC 6 cut(s) 89, 116, 169, 280, 284, 352
SspMI CTAG 4 cut(s) 41, 62, 132, 505
StuI AGGCCT 1 cut(s) 20
StyD4I CCNGG 1 cut(s) 15
StyI CCWWGG 2 cut(s) 150, 355
SwaI ATTTAAAT 1 cut(s) 82
TaaI ACNGT 3 cut(s) 72, 205, 428
TaiI ACGT 1 cut(s) 313
TaqI TCGA 5 cut(s) 328, 348, 367, 431, 459
TasI AATT 1 cut(s) 77
TatI WGTACW 1 cut(s) 27
TfiI GAWTC 2 cut(s) 93, 146
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TseFI GTSAC 1 cut(s) 291
Tsp45I GTSAC 1 cut(s) 291
VneI GTGCAC 1 cut(s) 99
VpaK11BI GGWCC 1 cut(s) 208
XapI RAATTY 1 cut(s) 77
XbaI TCTAGA 1 cut(s) 61
XceI RCATGY 1 cut(s) 299
XhoI CTCGAG 1 cut(s) 366
XspI CTAG 4 cut(s) 41, 62, 132, 505
Zsp2I ATGCAT 1 cut(s) 301
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.