Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000001

Orthogroup ID

OG0007563

Physical Location & Seq

Genomic Coordinates Reverse (-)

72102889 .. 72104420

Gene Structure 1532 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_1G00051460.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 267 bp

ATGCGGTTTGAAGATGATGGTGTAGAGTCGGTAAAGATCGTGAAGCAGTGGAAAGTGAAGAACTACTATGCGTCGGTGAGGGGTTTTAAGGACAAGTTGTTGTGGGCAGCTTTATTGTTATATGAGGCCACCGACAATGAGGAGTATTTGAGGATGGACCACCGAGCCGCCACGGGAAATTCCTCACCGTTTGTTGGTAAACTCCGAAACCTTGATGATTTAAACTCGCTTGGTTCCCTTGAGTTGTTTGATTCGAGAGAAGAGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00500 ko01100 map00500 map01100

Pfam Domains

Protein Families

Glyco_hydro_9

Protein Analysis

88

Amino Acids

10.2

Weight (kDa)

5.16

Isoelectric Point (pI)

35.35

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Glyco_hydro_9	PF00759	17 - 52	1.2e-06	Glycosyl hydrolase family 9

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007563)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0026455.1_g000001
rosa_roxburghii	Rroxscaffold_1G00027410 Rroxscaffold_1G00051460 Rroxscaffold_1G00062000 Rroxscaffold_2G00120690 Rroxscaffold_3G00226520 Rroxscaffold_3G00230550 Rroxscaffold_3G00232600 Rroxscaffold_3G00234920 Rroxscaffold_3G00238650 Rroxscaffold_3G00270030 Rroxscaffold_4G00286650 Rroxscaffold_4G00319170 Rroxscaffold_4G00323840 Rroxscaffold_5G00332770 Rroxscaffold_5G00338140 Rroxscaffold_6G00390570 Rroxscaffold_6G00391340 Rroxscaffold_6G00391910 Rroxscaffold_6G00391920 Rroxscaffold_6G00391930 Rroxscaffold_7G00159020 Rroxscaffold_7G00199420 Rroxscaffold_7G00204140
rosa_samantha	Rh5BG194200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	4, 168
AcsI	RAATTY	1 cut(s)	178
AfiI	CCNNNNNNNGG	1 cut(s)	194
AgsI	TTSAA	1 cut(s)	11
AluBI	AGCT	1 cut(s)	110
AluI	AGCT	1 cut(s)	110
AoxI	GGCC	1 cut(s)	126
ApeKI	GCWGC	1 cut(s)	107
ApoI	RAATTY	1 cut(s)	178
AspS9I	GGNCC	1 cut(s)	157
AsuHPI	GGTGA	2 cut(s)	88, 177
AvaII	GGWCC	1 cut(s)	157
BbvI	GCAGC	1 cut(s)	119
BccI	CCATC	2 cut(s)	11, 148
BisI	GCNGC	2 cut(s)	108, 168
BlsI	GCNGC	2 cut(s)	109, 169
Bme18I	GGWCC	1 cut(s)	157
BmgT120I	GGNCC	1 cut(s)	157
BmiI	GGNNCC	1 cut(s)	235
BpuEI	CTTGAG	1 cut(s)	260
BsaJI	CCNNGG	1 cut(s)	171
Bsc4I	CCNNNNNNNGG	1 cut(s)	194
BseDI	CCNNGG	1 cut(s)	171
BseGI	GGATG	1 cut(s)	159
BseLI	CCNNNNNNNGG	1 cut(s)	194
BseRI	GAGGAG	1 cut(s)	155
BseXI	GCAGC	1 cut(s)	119
BshFI	GGCC	1 cut(s)	128
BslI	CCNNNNNNNGG	1 cut(s)	194
BsnI	GGCC	1 cut(s)	128
Bsp143I	GATC	1 cut(s)	36
BspACI	CCGC	2 cut(s)	4, 168
BspANI	GGCC	1 cut(s)	128
BspLI	GGNNCC	1 cut(s)	235
BssECI	CCNNGG	1 cut(s)	171
BssMI	GATC	1 cut(s)	36
Bst4CI	ACNGT	1 cut(s)	189
Bst6I	CTCTTC	1 cut(s)	255
BstDSI	CCRYGG	1 cut(s)	171
BstF5I	GGATG	1 cut(s)	159
BstKTI	GATC	1 cut(s)	39
BstMBI	GATC	1 cut(s)	36
BstV1I	GCAGC	1 cut(s)	119
BsuRI	GGCC	1 cut(s)	128
BtgI	CCRYGG	1 cut(s)	171
BtsCI	GGATG	1 cut(s)	159
BtsI	GCAGTG	1 cut(s)	53
BtsIMutI	CAGTG	1 cut(s)	53
Cfr13I	GGNCC	1 cut(s)	157
CseI	GACGC	1 cut(s)	60
CviJI	RGCY	3 cut(s)	110, 128, 167
CviKI_1	RGCY	3 cut(s)	110, 128, 167
DpnI	GATC	1 cut(s)	38
DpnII	GATC	1 cut(s)	36
DraI	TTTAAA	1 cut(s)	222
Eam1104I	CTCTTC	1 cut(s)	255
EarI	CTCTTC	1 cut(s)	255
Eco47I	GGWCC	1 cut(s)	157
FaiI	YATR	3 cut(s)	69, 121, 123
Fnu4HI	GCNGC	2 cut(s)	108, 168
FokI	GGATG	1 cut(s)	166
Fsp4HI	GCNGC	2 cut(s)	108, 168
GluI	GCNGC	2 cut(s)	108, 168
HaeIII	GGCC	1 cut(s)	128
HgaI	GACGC	1 cut(s)	60
HinfI	GANTC	2 cut(s)	26, 251
HphI	GGTGA	2 cut(s)	88, 177
Hpy166II	GTNNAC	1 cut(s)	200
Hpy188I	TCNGA	1 cut(s)	206
Hpy188III	TCNNGA	2 cut(s)	40, 255
Hpy8I	GTNNAC	1 cut(s)	200
Hpy99I	CGWCG	1 cut(s)	76
HpyCH4III	ACNGT	1 cut(s)	189
Kzo9I	GATC	1 cut(s)	36
Lsp1109I	GCAGC	1 cut(s)	119
MalI	GATC	1 cut(s)	38
MboI	GATC	1 cut(s)	36
MboII	GAAGA	2 cut(s)	23, 70
MluCI	AATT	1 cut(s)	178
MlyI	GAGTC	1 cut(s)	35
MnlI	CCTC	5 cut(s)	72, 118, 133, 144, 193
MseI	TTAA	2 cut(s)	87, 221
NdeII	GATC	1 cut(s)	36
NlaIV	GGNNCC	1 cut(s)	235
PfeI	GAWTC	1 cut(s)	251
PkrI	GCNGC	2 cut(s)	109, 169
PleI	GAGTC	1 cut(s)	34
PpsI	GAGTC	1 cut(s)	34
PspN4I	GGNNCC	1 cut(s)	235
PspPI	GGNCC	1 cut(s)	157
SaqAI	TTAA	2 cut(s)	87, 221
SatI	GCNGC	2 cut(s)	108, 168
Sau3AI	GATC	1 cut(s)	36
Sau96I	GGNCC	1 cut(s)	157
SchI	GAGTC	1 cut(s)	35
SetI	ASST	2 cut(s)	112, 213
SgeI	CNNG	9 cut(s)	52, 106, 176, 184, 186, 224, 238, 242, 251
SinI	GGWCC	1 cut(s)	157
SmlI	CTYRAG	1 cut(s)	239
SmoI	CTYRAG	1 cut(s)	239
Sse9I	AATT	1 cut(s)	178
SsiI	CCGC	2 cut(s)	4, 168
TaaI	ACNGT	1 cut(s)	189
TaqI	TCGA	1 cut(s)	254
TasI	AATT	1 cut(s)	178
TauI	GCSGC	1 cut(s)	170
TfiI	GAWTC	1 cut(s)	251
Tru1I	TTAA	2 cut(s)	87, 221
Tru9I	TTAA	2 cut(s)	87, 221
TscAI	CASTG	1 cut(s)	53
TseI	GCWGC	1 cut(s)	107
TspRI	CASTG	1 cut(s)	53
VpaK11BI	GGWCC	1 cut(s)	157
XapI	RAATTY	1 cut(s)	178

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.