Rh7DG230400
MYB Family

DDE superfamily endonuclease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0011517
Physical Location & Seq
Reverse (-)
22807538 .. 22815927
8390 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG230400.1

Sequence Viewer

Length: 522 bp
ATGTGGATGAAGCCTTTTCCTCATTTTGATAACTTGGGAAATGTCTTTGGAAAAGATCGTGTTAATGGAAAGCAAGCAGCAAGTGCTACTGATTATGTGAATGAGATCGATCAAAACAATGATGGCCTAGATGACATTGCTGAAGTAATGAATATCCCTCCACCTGTAGTAGTAGTAGTAGAAGGTTCCAATCAAGCTCCAAGGAATAGGAAGATGAAGAGGACAAATGCATATGTACTAGGGTTGACCCAAATGGTTGGTGCAATGTCCAAGACTGCTGAAGCAATGGATAGGCTTGTGGGAAGTCTTGTAGAGCTTGATCCCATGCGTCAAGTCTATGATGAGGTATCCAAAGTTGAAGGTTTAAGTACCTCTTCTAAATTGAAAGTAAGTCAGATTATCATGGCTGATCCAATGAAAGAAGGAAGTGTGGCTATATCATCGTTACTATATCGGATGAATGAGGTCGTGAATGACACACTAGATATTATACTGACGAATTATGTACAAGACACTGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DDE_Tnp_4 Myb_DNA-bind_3

Protein Analysis

173

Amino Acids

19.13

Weight (kDa)

4.73

Isoelectric Point (pI)

23.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 314, 404
AcuI CTGAAG 2 cut(s) 162, 300
AfaI GTAC 3 cut(s) 237, 370, 507
AgsI TTSAA 2 cut(s) 359, 385
AluBI AGCT 2 cut(s) 197, 316
AluI AGCT 2 cut(s) 197, 316
AlwI GGATC 2 cut(s) 314, 404
AoxI GGCC 1 cut(s) 124
ApeKI GCWGC 1 cut(s) 77
BbvI GCAGC 1 cut(s) 89
BccI CCATC 1 cut(s) 116
BciVI GTATCC 1 cut(s) 358
BfaI CTAG 3 cut(s) 128, 239, 482
BfmI CTRYAG 1 cut(s) 165
BfuI GTATCC 1 cut(s) 358
BisI GCNGC 1 cut(s) 78
BlsI GCNGC 1 cut(s) 79
BmiI GGNNCC 1 cut(s) 187
Bsa29I ATCGAT 1 cut(s) 108
BsaJI CCNNGG 1 cut(s) 200
Bse3DI GCAATG 3 cut(s) 135, 270, 291
BseCI ATCGAT 1 cut(s) 108
BseDI CCNNGG 1 cut(s) 200
BseGI GGATG 2 cut(s) 12, 462
BseMI GCAATG 3 cut(s) 135, 270, 291
BseXI GCAGC 1 cut(s) 89
BshFI GGCC 1 cut(s) 126
BshVI ATCGAT 1 cut(s) 108
BsnI GGCC 1 cut(s) 126
Bsp1407I TGTACA 1 cut(s) 505
Bsp143I GATC 5 cut(s) 55, 105, 109, 319, 409
BspANI GGCC 1 cut(s) 126
BspDI ATCGAT 1 cut(s) 108
BspLI GGNNCC 1 cut(s) 187
BspPI GGATC 2 cut(s) 314, 404
BsrDI GCAATG 3 cut(s) 135, 270, 291
BsrGI TGTACA 1 cut(s) 505
BssECI CCNNGG 1 cut(s) 200
BssMI GATC 5 cut(s) 55, 105, 109, 319, 409
BssT1I CCWWGG 1 cut(s) 200
Bst6I CTCTTC 2 cut(s) 212, 379
BstAPI GCANNNNNTGC 1 cut(s) 83
BstAUI TGTACA 1 cut(s) 505
BstC8I GCNNGC 1 cut(s) 75
BstF5I GGATG 2 cut(s) 12, 462
BstKTI GATC 5 cut(s) 58, 108, 112, 322, 412
BstMBI GATC 5 cut(s) 55, 105, 109, 319, 409
BstMWI GCNNNNNNNGC 1 cut(s) 83
BstSFI CTRYAG 1 cut(s) 165
BstV1I GCAGC 1 cut(s) 89
BstXI CCANNNNNNTGG 1 cut(s) 257
Bsu15I ATCGAT 1 cut(s) 108
BsuI GTATCC 1 cut(s) 358
BsuRI GGCC 1 cut(s) 126
BsuTUI ATCGAT 1 cut(s) 108
BtsCI GGATG 2 cut(s) 12, 462
BtsIMutI CAGTG 1 cut(s) 513
Cac8I GCNNGC 1 cut(s) 75
ClaI ATCGAT 1 cut(s) 108
CseI GACGC 1 cut(s) 317
Csp6I GTAC 3 cut(s) 236, 369, 506
CviAII CATG 2 cut(s) 325, 403
CviJI RGCY 7 cut(s) 13, 126, 197, 295, 316, 407, 434
CviKI_1 RGCY 7 cut(s) 13, 126, 197, 295, 316, 407, 434
CviQI GTAC 3 cut(s) 236, 369, 506
DpnI GATC 5 cut(s) 57, 107, 111, 321, 411
DpnII GATC 5 cut(s) 55, 105, 109, 319, 409
Eam1104I CTCTTC 2 cut(s) 212, 379
EarI CTCTTC 2 cut(s) 212, 379
Eco130I CCWWGG 1 cut(s) 200
Eco57I CTGAAG 2 cut(s) 162, 300
EcoT14I CCWWGG 1 cut(s) 200
EcoT22I ATGCAT 1 cut(s) 232
ErhI CCWWGG 1 cut(s) 200
FaeI CATG 2 cut(s) 328, 406
FalI AAGNNNNNCTT 2 cut(s) 358, 390
FatI CATG 2 cut(s) 324, 402
FauNDI CATATG 1 cut(s) 232
Fnu4HI GCNGC 1 cut(s) 78
FokI GGATG 2 cut(s) 19, 469
Fsp4HI GCNGC 1 cut(s) 78
FspBI CTAG 3 cut(s) 128, 239, 482
GluI GCNGC 1 cut(s) 78
HaeIII GGCC 1 cut(s) 126
HgaI GACGC 1 cut(s) 317
Hin1II CATG 2 cut(s) 328, 406
HincII GTYRAC 1 cut(s) 246
HindII GTYRAC 1 cut(s) 246
Hpy166II GTNNAC 1 cut(s) 246
Hpy188I TCNGA 2 cut(s) 396, 456
Hpy188III TCNNGA 1 cut(s) 469
Hpy8I GTNNAC 1 cut(s) 246
HpyAV CCTTC 3 cut(s) 176, 353, 416
HpyCH4V TGCA 2 cut(s) 230, 263
HpyF10VI GCNNNNNNNGC 1 cut(s) 83
Hsp92II CATG 2 cut(s) 328, 406
Kzo9I GATC 5 cut(s) 55, 105, 109, 319, 409
LmnI GCTCC 1 cut(s) 202
LpnPI CCDG 1 cut(s) 177
Lsp1109I GCAGC 1 cut(s) 89
MaeI CTAG 3 cut(s) 128, 239, 482
MaeIII GTNAC 1 cut(s) 444
MalI GATC 5 cut(s) 57, 107, 111, 321, 411
MboI GATC 5 cut(s) 55, 105, 109, 319, 409
MboII GAAGA 3 cut(s) 223, 229, 366
MluCI AATT 2 cut(s) 380, 499
MnlI CCTC 6 cut(s) 30, 168, 213, 337, 382, 457
Mph1103I ATGCAT 1 cut(s) 232
MseI TTAA 2 cut(s) 63, 365
MwoI GCNNNNNNNGC 1 cut(s) 83
NdeI CATATG 1 cut(s) 232
NdeII GATC 5 cut(s) 55, 105, 109, 319, 409
NlaIII CATG 2 cut(s) 328, 406
NlaIV GGNNCC 1 cut(s) 187
NsiI ATGCAT 1 cut(s) 232
PkrI GCNGC 1 cut(s) 79
PspN4I GGNNCC 1 cut(s) 187
RsaI GTAC 3 cut(s) 237, 370, 507
RsaNI GTAC 3 cut(s) 236, 369, 506
SaqAI TTAA 2 cut(s) 63, 365
SatI GCNGC 1 cut(s) 78
Sau3AI GATC 5 cut(s) 55, 105, 109, 319, 409
SetI ASST 8 cut(s) 166, 187, 199, 318, 348, 364, 374, 468
SfcI CTRYAG 1 cut(s) 165
Sse9I AATT 2 cut(s) 380, 499
SspMI CTAG 3 cut(s) 128, 239, 482
StyI CCWWGG 1 cut(s) 200
TaqI TCGA 1 cut(s) 108
TasI AATT 2 cut(s) 380, 499
TatI WGTACW 2 cut(s) 235, 505
Tru1I TTAA 2 cut(s) 63, 365
Tru9I TTAA 2 cut(s) 63, 365
TscAI CASTG 1 cut(s) 520
TseI GCWGC 1 cut(s) 77
TspDTI ATGAA 5 cut(s) 23, 164, 230, 431, 473
TspRI CASTG 1 cut(s) 520
XspI CTAG 3 cut(s) 128, 239, 482
Zsp2I ATGCAT 1 cut(s) 232
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.