Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0013146.1

Orthogroup ID

OG0011517

Physical Location & Seq

Genomic Coordinates Forward (+)

10980 .. 11400

Gene Structure 421 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0013146.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 366 bp

atgagcgagcatagaaaagatcgtgttaatggaaagcaagcagcaagtgccattgattatgtcgatgagattgatcaaaacaatgatgacctagacgacattgctgaagtgatgactatccctccacatgtagtagcagaaggttccaatcaagctccaaggaataggagaaggaagaggacaggtgcatatgtactagggttgacacaaatggttggtgcaatgtcgaagactgctaaagcaatggataagcttgtgagaagtcttgtagaacttgatcccatgcgtcaagcagtctatgatgaggtagccaaagttgaaggtgaaagctctaatagagaagcccagataatactgaggaaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DDE_Tnp_4 Myb_DNA-bind_3

Protein Analysis

121

Amino Acids

13.52

Weight (kDa)

6.12

Isoelectric Point (pI)

38.05

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011517)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g28531 FvH4_4g08331
rosa_chinensis	RchiOBHm_Chr7g0205671
rosa_laevigata	RLG00000016732 RLG00000019543
rosa_multiflora	Rmu_sc0000233.1_g000007 Rmu_sc0006124.1_g000004 Rmu_sc0013146.1_g000002
rosa_roxburghii	Rroxscaffold_2G00092690 Rroxscaffold_3G00250230
rosa_samantha	Rh1CG035800 Rh3CG122900 Rh3CG285100 Rh5BG382900 Rh7AG223400 Rh7AG241400 Rh7BG236100 Rh7CG145700 Rh7CG236700 Rh7DG230400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	272
AcuI	CTGAAG	1 cut(s)	126
AfaI	GTAC	1 cut(s)	195
AflIII	ACRYGT	1 cut(s)	127
AgsI	TTSAA	1 cut(s)	320
AluBI	AGCT	3 cut(s)	155, 253, 330
AluI	AGCT	3 cut(s)	155, 253, 330
AlwI	GGATC	1 cut(s)	272
ApeKI	GCWGC	1 cut(s)	41
AsuHPI	GGTGA	1 cut(s)	335
BbsI	GAAGAC	1 cut(s)	236
BbvI	GCAGC	1 cut(s)	53
BclI	TGATCA	1 cut(s)	73
BfaI	CTAG	2 cut(s)	92, 197
BisI	GCNGC	1 cut(s)	42
BlsI	GCNGC	1 cut(s)	43
BmiI	GGNNCC	1 cut(s)	145
BpiI	GAAGAC	1 cut(s)	236
BsaBI	GATNNNNATC	1 cut(s)	116
BsaJI	CCNNGG	1 cut(s)	158
BsaXI	ACNNNNNCTCC	2 cut(s)	106, 136
Bse3DI	GCAATG	3 cut(s)	99, 228, 249
Bse8I	GATNNNNATC	1 cut(s)	116
BseDI	CCNNGG	1 cut(s)	158
BseJI	GATNNNNATC	1 cut(s)	116
BseMI	GCAATG	3 cut(s)	99, 228, 249
BseMII	CTCAG	1 cut(s)	347
BseXI	GCAGC	1 cut(s)	53
Bsp143I	GATC	3 cut(s)	19, 73, 277
BspCNI	CTCAG	1 cut(s)	348
BspLI	GGNNCC	1 cut(s)	145
BspPI	GGATC	1 cut(s)	272
BsrDI	GCAATG	3 cut(s)	99, 228, 249
BssECI	CCNNGG	1 cut(s)	158
BssMI	GATC	3 cut(s)	19, 73, 277
BssT1I	CCWWGG	1 cut(s)	158
Bst6I	CTCTTC	1 cut(s)	170
BstAPI	GCANNNNNTGC	1 cut(s)	47
BstC8I	GCNNGC	2 cut(s)	8, 39
BstDEI	CTNAG	1 cut(s)	356
BstKTI	GATC	3 cut(s)	22, 76, 280
BstMBI	GATC	3 cut(s)	19, 73, 277
BstMWI	GCNNNNNNNGC	1 cut(s)	47
BstNSI	RCATGY	1 cut(s)	131
BstV1I	GCAGC	1 cut(s)	53
BstV2I	GAAGAC	1 cut(s)	236
Cac8I	GCNNGC	2 cut(s)	8, 39
CseI	GACGC	1 cut(s)	275
Csp6I	GTAC	1 cut(s)	194
CviAII	CATG	2 cut(s)	128, 283
CviJI	RGCY	5 cut(s)	155, 253, 311, 330, 344
CviKI_1	RGCY	5 cut(s)	155, 253, 311, 330, 344
CviQI	GTAC	1 cut(s)	194
DdeI	CTNAG	1 cut(s)	356
DpnI	GATC	3 cut(s)	21, 75, 279
DpnII	GATC	3 cut(s)	19, 73, 277
Eam1104I	CTCTTC	1 cut(s)	170
EarI	CTCTTC	1 cut(s)	170
Eco130I	CCWWGG	1 cut(s)	158
Eco57I	CTGAAG	1 cut(s)	126
EcoT14I	CCWWGG	1 cut(s)	158
ErhI	CCWWGG	1 cut(s)	158
FaeI	CATG	2 cut(s)	131, 286
FaiI	YATR	7 cut(s)	12, 60, 129, 190, 192, 284, 300
FatI	CATG	2 cut(s)	127, 282
FauNDI	CATATG	1 cut(s)	190
FbaI	TGATCA	1 cut(s)	73
Fnu4HI	GCNGC	1 cut(s)	42
Fsp4HI	GCNGC	1 cut(s)	42
FspBI	CTAG	2 cut(s)	92, 197
GluI	GCNGC	1 cut(s)	42
HgaI	GACGC	1 cut(s)	275
Hin1II	CATG	2 cut(s)	131, 286
HincII	GTYRAC	1 cut(s)	204
HindII	GTYRAC	1 cut(s)	204
HindIII	AAGCTT	1 cut(s)	251
HphI	GGTGA	1 cut(s)	335
Hpy166II	GTNNAC	1 cut(s)	204
Hpy8I	GTNNAC	1 cut(s)	204
HpyAV	CCTTC	3 cut(s)	134, 165, 314
HpyCH4V	TGCA	2 cut(s)	188, 221
HpyF10VI	GCNNNNNNNGC	1 cut(s)	47
HpyF3I	CTNAG	1 cut(s)	356
Hsp92II	CATG	2 cut(s)	131, 286
Ksp22I	TGATCA	1 cut(s)	73
Kzo9I	GATC	3 cut(s)	19, 73, 277
LmnI	GCTCC	1 cut(s)	160
LpnPI	CCDG	2 cut(s)	168, 359
Lsp1109I	GCAGC	1 cut(s)	53
MaeI	CTAG	2 cut(s)	92, 197
MalI	GATC	3 cut(s)	21, 75, 279
MboI	GATC	3 cut(s)	19, 73, 277
MboII	GAAGA	2 cut(s)	187, 241
MnlI	CCTC	4 cut(s)	132, 171, 298, 351
MseI	TTAA	1 cut(s)	27
MwoI	GCNNNNNNNGC	1 cut(s)	47
NdeI	CATATG	1 cut(s)	190
NdeII	GATC	3 cut(s)	19, 73, 277
NlaIII	CATG	2 cut(s)	131, 286
NlaIV	GGNNCC	1 cut(s)	145
NspI	RCATGY	1 cut(s)	131
PciI	ACATGT	1 cut(s)	127
PkrI	GCNGC	1 cut(s)	43
PscI	ACATGT	1 cut(s)	127
PspN4I	GGNNCC	1 cut(s)	145
RsaI	GTAC	1 cut(s)	195
RsaNI	GTAC	1 cut(s)	194
SaqAI	TTAA	1 cut(s)	27
SatI	GCNGC	1 cut(s)	42
Sau3AI	GATC	3 cut(s)	19, 73, 277
SetI	ASST	8 cut(s)	93, 145, 157, 187, 255, 309, 325, 332
SspMI	CTAG	2 cut(s)	92, 197
StyI	CCWWGG	1 cut(s)	158
TaqI	TCGA	2 cut(s)	63, 227
TatI	WGTACW	1 cut(s)	193
Tru1I	TTAA	1 cut(s)	27
Tru9I	TTAA	1 cut(s)	27
TseI	GCWGC	1 cut(s)	41
XceI	RCATGY	1 cut(s)	131
XspI	CTAG	2 cut(s)	92, 197

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.