Rh3CG285100
MYB Family

DDE superfamily endonuclease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
OG0011517
Physical Location & Seq
Forward (+)
28705330 .. 28705662
333 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG285100.1

Sequence Viewer

Length: 333 bp
ATGACTATCCCTCCACCTGTAGTAGTAGAAGGTTCCAATCAAGCTCAAAGGAATAGGAAAAGGAAGAGGATAGATGCGTATGTACTAGGGTTGACCCAAATGGTTGGTGCAATGTCCAAGACTGCTGAAGCAATGGATAGGCTTGTGGGAAGTCTTGCAGAGCTTGATCCCATGCGTCAAGTCTATGATGAGGTATCCAAAGTTGAAGGTTTAAGTACCTCTTCTAAATTGAAAGTAAGTCAGATTATCATGGCTGATCCAATGAAAGTGAGTCTTCCTCTTAGTCTTCCTGGAGATGTTAAAAAAGAATGGGTGGAAGAATTGCTGCAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DDE_Tnp_4 Myb_DNA-bind_3

Protein Analysis

110

Amino Acids

12.15

Weight (kDa)

7.96

Isoelectric Point (pI)

28.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 161, 251
AcuI CTGAAG 1 cut(s) 147
AfaI GTAC 2 cut(s) 84, 217
AgsI TTSAA 2 cut(s) 206, 232
AjnI CCWGG 1 cut(s) 289
AluBI AGCT 2 cut(s) 44, 163
AluI AGCT 2 cut(s) 44, 163
AlwI GGATC 2 cut(s) 161, 251
ApeKI GCWGC 1 cut(s) 325
BbsI GAAGAC 2 cut(s) 266, 278
BbvI GCAGC 1 cut(s) 312
BciT130I CCWGG 1 cut(s) 291
BciVI GTATCC 1 cut(s) 205
BfaI CTAG 1 cut(s) 86
BfmI CTRYAG 1 cut(s) 18
BfuI GTATCC 1 cut(s) 205
BisI GCNGC 1 cut(s) 326
BlsI GCNGC 1 cut(s) 327
Bme1390I CCNGG 1 cut(s) 291
BmiI GGNNCC 1 cut(s) 34
BmrFI CCNGG 1 cut(s) 291
BmsI GCATC 1 cut(s) 64
BpiI GAAGAC 2 cut(s) 266, 278
BplI GAGNNNNNCTC 2 cut(s) 262, 294
BpmI CTGGAG 1 cut(s) 312
BsaXI ACNNNNNCTCC 1 cut(s) 25
Bse3DI GCAATG 2 cut(s) 117, 138
BseBI CCWGG 1 cut(s) 291
BseMI GCAATG 2 cut(s) 117, 138
BseXI GCAGC 1 cut(s) 312
Bsp143I GATC 2 cut(s) 166, 256
BspLI GGNNCC 1 cut(s) 34
BspPI GGATC 2 cut(s) 161, 251
BsrDI GCAATG 2 cut(s) 117, 138
BssMI GATC 2 cut(s) 166, 256
Bst2UI CCWGG 1 cut(s) 291
Bst6I CTCTTC 2 cut(s) 59, 226
BstDEI CTNAG 1 cut(s) 281
BstKTI GATC 2 cut(s) 169, 259
BstMBI GATC 2 cut(s) 166, 256
BstNI CCWGG 1 cut(s) 291
BstSCI CCNGG 1 cut(s) 289
BstSFI CTRYAG 1 cut(s) 18
BstV1I GCAGC 1 cut(s) 312
BstV2I GAAGAC 2 cut(s) 266, 278
BstXI CCANNNNNNTGG 1 cut(s) 104
BsuI GTATCC 1 cut(s) 205
CseI GACGC 1 cut(s) 164
Csp6I GTAC 2 cut(s) 83, 216
CviAII CATG 2 cut(s) 172, 250
CviJI RGCY 4 cut(s) 44, 142, 163, 254
CviKI_1 RGCY 4 cut(s) 44, 142, 163, 254
CviQI GTAC 2 cut(s) 83, 216
DdeI CTNAG 1 cut(s) 281
DpnI GATC 2 cut(s) 168, 258
DpnII GATC 2 cut(s) 166, 256
Eam1104I CTCTTC 2 cut(s) 59, 226
EarI CTCTTC 2 cut(s) 59, 226
Eco57I CTGAAG 1 cut(s) 147
EcoRII CCWGG 1 cut(s) 289
FaeI CATG 2 cut(s) 175, 253
FaiI YATR 4 cut(s) 81, 173, 186, 251
FalI AAGNNNNNCTT 4 cut(s) 205, 237, 258, 290
FatI CATG 2 cut(s) 171, 249
Fnu4HI GCNGC 1 cut(s) 326
Fsp4HI GCNGC 1 cut(s) 326
FspBI CTAG 1 cut(s) 86
GluI GCNGC 1 cut(s) 326
GsuI CTGGAG 1 cut(s) 312
HgaI GACGC 1 cut(s) 164
Hin1II CATG 2 cut(s) 175, 253
HincII GTYRAC 1 cut(s) 93
HindII GTYRAC 1 cut(s) 93
HinfI GANTC 1 cut(s) 271
Hpy166II GTNNAC 1 cut(s) 93
Hpy188I TCNGA 1 cut(s) 243
Hpy8I GTNNAC 1 cut(s) 93
HpyAV CCTTC 2 cut(s) 23, 200
HpyCH4V TGCA 3 cut(s) 110, 158, 328
HpyF3I CTNAG 1 cut(s) 281
Hsp92II CATG 2 cut(s) 175, 253
Kzo9I GATC 2 cut(s) 166, 256
LpnPI CCDG 3 cut(s) 30, 276, 303
Lsp1109I GCAGC 1 cut(s) 312
LweI GCATC 1 cut(s) 64
MaeI CTAG 1 cut(s) 86
MalI GATC 2 cut(s) 168, 258
MboI GATC 2 cut(s) 166, 256
MboII GAAGA 5 cut(s) 76, 213, 266, 278, 329
MluCI AATT 2 cut(s) 227, 320
MlyI GAGTC 1 cut(s) 280
MnlI CCTC 5 cut(s) 21, 60, 184, 229, 288
MseI TTAA 2 cut(s) 212, 300
MspR9I CCNGG 1 cut(s) 291
MvaI CCWGG 1 cut(s) 291
NdeII GATC 2 cut(s) 166, 256
NlaIII CATG 2 cut(s) 175, 253
NlaIV GGNNCC 1 cut(s) 34
PfoI TCCNGGA 1 cut(s) 289
PkrI GCNGC 1 cut(s) 327
PleI GAGTC 1 cut(s) 279
PpsI GAGTC 1 cut(s) 279
Psp6I CCWGG 1 cut(s) 289
PspGI CCWGG 1 cut(s) 289
PspN4I GGNNCC 1 cut(s) 34
RsaI GTAC 2 cut(s) 84, 217
RsaNI GTAC 2 cut(s) 83, 216
SaqAI TTAA 2 cut(s) 212, 300
SatI GCNGC 1 cut(s) 326
Sau3AI GATC 2 cut(s) 166, 256
SchI GAGTC 1 cut(s) 280
ScrFI CCNGG 1 cut(s) 291
SetI ASST 7 cut(s) 19, 34, 46, 165, 195, 211, 221
SfaNI GCATC 1 cut(s) 64
SfcI CTRYAG 1 cut(s) 18
Sse9I AATT 2 cut(s) 227, 320
SspMI CTAG 1 cut(s) 86
StyD4I CCNGG 1 cut(s) 289
TasI AATT 2 cut(s) 227, 320
TatI WGTACW 1 cut(s) 82
Tru1I TTAA 2 cut(s) 212, 300
Tru9I TTAA 2 cut(s) 212, 300
TseI GCWGC 1 cut(s) 325
TspDTI ATGAA 1 cut(s) 278
XspI CTAG 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.