Rh2BG304800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0006927
Physical Location & Seq
Reverse (-)
35347842 .. 35348186
345 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG304800.1

Sequence Viewer

Length: 345 bp
ATGGAATTGCAAAGTAATAGCAAATCAGAAGAAGCGAAGTCCGCAGAAGAAGTTAAGTCTACGAGAGGTCGAGACATTAATCCTTATTATGAGATCTGTTATGGCCATGTCGGTCACCAATCCTGGGAATGTCCTGACAAATCAAAGGGAATGGGAATCGGTTGGTTTCTTTGTTATGGCCCCTGTAAAAAGAAAGATGATGGTGAGCACTGGTCTATTGAAATGGTCAAATATTGTATCGTTTGTGGGTCTATGGGGAGGCATTGGGGTGATGACTGCCCCTATTGGTTTGAAGCTGAAGTGGATAATTCCGAGATAAGTGATGATGATTATGTTGCATTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

114

Amino Acids

13.11

Weight (kDa)

4.7

Isoelectric Point (pI)

34.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 59
AciI CCGC 1 cut(s) 42
AcoI YGGCCR 1 cut(s) 103
AcuI CTGAAG 1 cut(s) 318
AfiI CCNNNNNNNGG 1 cut(s) 124
AgsI TTSAA 2 cut(s) 221, 293
AjnI CCWGG 1 cut(s) 122
AluBI AGCT 1 cut(s) 296
AluI AGCT 1 cut(s) 296
Alw21I GWGCWC 1 cut(s) 210
Alw26I GTCTC 1 cut(s) 66
AoxI GGCC 2 cut(s) 103, 178
AseI ATTAAT 1 cut(s) 78
AspS9I GGNCC 1 cut(s) 179
AsuHPI GGTGA 3 cut(s) 107, 215, 281
BalI TGGCCA 1 cut(s) 105
Bbv12I GWGCWC 1 cut(s) 210
BccI CCATC 1 cut(s) 194
BciT130I CCWGG 1 cut(s) 124
BcoDI GTCTC 1 cut(s) 66
BfaI CTAG 1 cut(s) 343
BglII AGATCT 1 cut(s) 93
Bme1390I CCNGG 1 cut(s) 124
BmgT120I GGNCC 1 cut(s) 179
BmiI GGNNCC 1 cut(s) 181
BmrFI CCNGG 1 cut(s) 124
BsaJI CCNNGG 1 cut(s) 123
Bsc4I CCNNNNNNNGG 1 cut(s) 124
Bse1I ACTGG 1 cut(s) 215
BseBI CCWGG 1 cut(s) 124
BseDI CCNNGG 1 cut(s) 123
BseLI CCNNNNNNNGG 1 cut(s) 124
BseNI ACTGG 1 cut(s) 215
BshFI GGCC 2 cut(s) 105, 180
BsiHKAI GWGCWC 1 cut(s) 210
BslI CCNNNNNNNGG 1 cut(s) 124
BsmAI GTCTC 1 cut(s) 66
BsmI GAATGC 1 cut(s) 338
BsnI GGCC 2 cut(s) 105, 180
Bsp1286I GDGCHC 1 cut(s) 210
Bsp143I GATC 1 cut(s) 93
BspACI CCGC 1 cut(s) 42
BspANI GGCC 2 cut(s) 105, 180
BspLI GGNNCC 1 cut(s) 181
BsrI ACTGG 1 cut(s) 215
BssECI CCNNGG 1 cut(s) 123
BssMI GATC 1 cut(s) 93
Bst2UI CCWGG 1 cut(s) 124
BstEII GGTNACC 1 cut(s) 113
BstKTI GATC 1 cut(s) 96
BstMAI GTCTC 1 cut(s) 66
BstMBI GATC 1 cut(s) 93
BstMWI GCNNNNNNNGC 1 cut(s) 41
BstNI CCWGG 1 cut(s) 124
BstPI GGTNACC 1 cut(s) 113
BstSCI CCNGG 1 cut(s) 122
BstX2I RGATCY 1 cut(s) 93
BstYI RGATCY 1 cut(s) 93
BsuRI GGCC 2 cut(s) 105, 180
BtsIMutI CAGTG 1 cut(s) 208
Cfr13I GGNCC 1 cut(s) 179
CviAII CATG 1 cut(s) 107
CviJI RGCY 3 cut(s) 105, 180, 296
CviKI_1 RGCY 3 cut(s) 105, 180, 296
DpnI GATC 1 cut(s) 95
DpnII GATC 1 cut(s) 93
EaeI YGGCCR 1 cut(s) 103
Eco57I CTGAAG 1 cut(s) 318
Eco91I GGTNACC 1 cut(s) 113
EcoO65I GGTNACC 1 cut(s) 113
EcoRII CCWGG 1 cut(s) 122
FaeI CATG 1 cut(s) 110
FaiI YATR 6 cut(s) 90, 102, 108, 177, 254, 333
FatI CATG 1 cut(s) 106
FblI GTMKAC 1 cut(s) 59
FspBI CTAG 1 cut(s) 343
HaeIII GGCC 2 cut(s) 105, 180
Hin1II CATG 1 cut(s) 110
HinfI GANTC 1 cut(s) 156
HphI GGTGA 3 cut(s) 107, 215, 281
Hpy166II GTNNAC 1 cut(s) 60
Hpy188I TCNGA 2 cut(s) 28, 313
Hpy188III TCNNGA 2 cut(s) 71, 134
Hpy8I GTNNAC 1 cut(s) 60
HpyCH4V TGCA 2 cut(s) 10, 338
HpyF10VI GCNNNNNNNGC 1 cut(s) 41
Hsp92II CATG 1 cut(s) 110
Kzo9I GATC 1 cut(s) 93
LpnPI CCDG 5 cut(s) 109, 136, 147, 196, 196
MaeI CTAG 1 cut(s) 343
MaeIII GTNAC 1 cut(s) 113
MalI GATC 1 cut(s) 95
MboI GATC 1 cut(s) 93
MboII GAAGA 2 cut(s) 41, 59
MflI RGATCY 1 cut(s) 93
MhlI GDGCHC 1 cut(s) 210
MlsI TGGCCA 1 cut(s) 105
MluCI AATT 2 cut(s) 5, 307
MluNI TGGCCA 1 cut(s) 105
MnlI CCTC 2 cut(s) 59, 252
Mox20I TGGCCA 1 cut(s) 105
MscI TGGCCA 1 cut(s) 105
MseI TTAA 2 cut(s) 54, 78
MslI CAYNNNNRTG 1 cut(s) 267
Msp20I TGGCCA 1 cut(s) 105
MspR9I CCNGG 1 cut(s) 124
Mva1269I GAATGC 1 cut(s) 338
MvaI CCWGG 1 cut(s) 124
MwoI GCNNNNNNNGC 1 cut(s) 41
NdeII GATC 1 cut(s) 93
NlaIII CATG 1 cut(s) 110
NlaIV GGNNCC 1 cut(s) 181
NmuCI GTSAC 1 cut(s) 113
PctI GAATGC 1 cut(s) 338
PfeI GAWTC 1 cut(s) 156
PshBI ATTAAT 1 cut(s) 78
Psp6I CCWGG 1 cut(s) 122
PspEI GGTNACC 1 cut(s) 113
PspGI CCWGG 1 cut(s) 122
PspN4I GGNNCC 1 cut(s) 181
PspPI GGNCC 1 cut(s) 179
PsuI RGATCY 1 cut(s) 93
RseI CAYNNNNRTG 1 cut(s) 267
SaqAI TTAA 2 cut(s) 54, 78
Sau3AI GATC 1 cut(s) 93
Sau96I GGNCC 1 cut(s) 179
ScrFI CCNGG 1 cut(s) 124
SduI GDGCHC 1 cut(s) 210
SetI ASST 2 cut(s) 70, 298
SgeI CNNG 9 cut(s) 75, 83, 119, 135, 136, 146, 195, 223, 325
SmiMI CAYNNNNRTG 1 cut(s) 267
Sse9I AATT 2 cut(s) 5, 307
SsiI CCGC 1 cut(s) 42
SspI AATATT 1 cut(s) 233
SspMI CTAG 1 cut(s) 343
StyD4I CCNGG 1 cut(s) 122
TaqI TCGA 1 cut(s) 70
TaqII GACCGA 1 cut(s) 101
TasI AATT 2 cut(s) 5, 307
TfiI GAWTC 1 cut(s) 156
Tru1I TTAA 2 cut(s) 54, 78
Tru9I TTAA 2 cut(s) 54, 78
TscAI CASTG 1 cut(s) 215
TseFI GTSAC 1 cut(s) 113
Tsp45I GTSAC 1 cut(s) 113
TspRI CASTG 1 cut(s) 215
VspI ATTAAT 1 cut(s) 78
XmiI GTMKAC 1 cut(s) 59
XspI CTAG 1 cut(s) 343
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.