Rmu_sc0004279.1_g000021

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004279.1
OG0006927
Physical Location & Seq
Forward (+)
90502 .. 90861
360 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004279.1_g000021.1.cds

Sequence Viewer

Length: 360 bp
atggaattgcaaatacgtagcaaatcagaagaagcgaagtccgcagaagcagttgagtctacgggaggtcgagacattaatccttattgtgagatctgttatggccatgtcggtcaccaatcctgggattgccctgacaaatcaaagggaatgggaatgggttgtcgtctttgttatggcccctgtaaaaagaatgagcatgaagatgatgatgatggtgagcaccgctctattgaaatggtcaaatattgtatcgtttgtgggtctatgggtaggcactggggtgatgactgcccctattggtctgaagctaaagtggataattccgagataagtgatgatgattatgttgcgttttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

119

Amino Acids

13.41

Weight (kDa)

4.66

Isoelectric Point (pI)

34.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 228
AccI GTMKAC 1 cut(s) 59
AciI CCGC 2 cut(s) 42, 226
AcoI YGGCCR 1 cut(s) 103
AcuI CTGAAG 1 cut(s) 327
AfiI CCNNNNNNNGG 1 cut(s) 124
AgsI TTSAA 1 cut(s) 236
AjnI CCWGG 1 cut(s) 122
AleI CACNNNNGTG 1 cut(s) 282
AluBI AGCT 1 cut(s) 311
AluI AGCT 1 cut(s) 311
Alw21I GWGCWC 1 cut(s) 225
Alw26I GTCTC 1 cut(s) 66
AoxI GGCC 2 cut(s) 103, 178
AseI ATTAAT 1 cut(s) 78
AspS9I GGNCC 1 cut(s) 179
AsuHPI GGTGA 3 cut(s) 107, 230, 296
BalI TGGCCA 1 cut(s) 105
Bbv12I GWGCWC 1 cut(s) 225
BccI CCATC 1 cut(s) 209
BciT130I CCWGG 1 cut(s) 124
BcoDI GTCTC 1 cut(s) 66
BglII AGATCT 1 cut(s) 93
Bme1390I CCNGG 1 cut(s) 124
BmgT120I GGNCC 1 cut(s) 179
BmiI GGNNCC 1 cut(s) 181
BmrFI CCNGG 1 cut(s) 124
BmrI ACTGGG 1 cut(s) 289
BmuI ACTGGG 1 cut(s) 289
BplI GAGNNNNNCTC 2 cut(s) 212, 244
BsaAI YACGTR 1 cut(s) 17
BsaJI CCNNGG 1 cut(s) 123
Bsc4I CCNNNNNNNGG 1 cut(s) 124
Bse1I ACTGG 1 cut(s) 284
BseBI CCWGG 1 cut(s) 124
BseDI CCNNGG 1 cut(s) 123
BseLI CCNNNNNNNGG 1 cut(s) 124
BseNI ACTGG 1 cut(s) 284
BshFI GGCC 2 cut(s) 105, 180
BsiHKAI GWGCWC 1 cut(s) 225
BslI CCNNNNNNNGG 1 cut(s) 124
BsmAI GTCTC 1 cut(s) 66
BsnI GGCC 2 cut(s) 105, 180
Bsp1286I GDGCHC 1 cut(s) 225
Bsp143I GATC 1 cut(s) 93
BspACI CCGC 2 cut(s) 42, 226
BspANI GGCC 2 cut(s) 105, 180
BspLI GGNNCC 1 cut(s) 181
BsrBI CCGCTC 1 cut(s) 228
BsrI ACTGG 1 cut(s) 284
BssECI CCNNGG 1 cut(s) 123
BssMI GATC 1 cut(s) 93
Bst2UI CCWGG 1 cut(s) 124
BstBAI YACGTR 1 cut(s) 17
BstEII GGTNACC 1 cut(s) 113
BstKTI GATC 1 cut(s) 96
BstMAI GTCTC 1 cut(s) 66
BstMBI GATC 1 cut(s) 93
BstMWI GCNNNNNNNGC 1 cut(s) 41
BstNI CCWGG 1 cut(s) 124
BstPI GGTNACC 1 cut(s) 113
BstSCI CCNGG 1 cut(s) 122
BstSNI TACGTA 1 cut(s) 17
BstX2I RGATCY 1 cut(s) 93
BstYI RGATCY 1 cut(s) 93
BsuRI GGCC 2 cut(s) 105, 180
BtsIMutI CAGTG 1 cut(s) 277
Cfr13I GGNCC 1 cut(s) 179
CviAII CATG 2 cut(s) 107, 200
CviJI RGCY 3 cut(s) 105, 180, 311
CviKI_1 RGCY 3 cut(s) 105, 180, 311
DpnI GATC 1 cut(s) 95
DpnII GATC 1 cut(s) 93
EaeI YGGCCR 1 cut(s) 103
Eco105I TACGTA 1 cut(s) 17
Eco57I CTGAAG 1 cut(s) 327
Eco91I GGTNACC 1 cut(s) 113
EcoO65I GGTNACC 1 cut(s) 113
EcoRII CCWGG 1 cut(s) 122
FaeI CATG 2 cut(s) 110, 203
FaiI YATR 6 cut(s) 102, 108, 177, 201, 269, 348
FatI CATG 2 cut(s) 106, 199
FblI GTMKAC 1 cut(s) 59
HaeIII GGCC 2 cut(s) 105, 180
Hin1II CATG 2 cut(s) 110, 203
HinfI GANTC 1 cut(s) 56
HphI GGTGA 3 cut(s) 107, 230, 296
Hpy166II GTNNAC 1 cut(s) 60
Hpy188I TCNGA 3 cut(s) 28, 307, 328
Hpy188III TCNNGA 1 cut(s) 71
Hpy8I GTNNAC 1 cut(s) 60
HpyCH4IV ACGT 1 cut(s) 16
HpyCH4V TGCA 1 cut(s) 10
HpyF10VI GCNNNNNNNGC 1 cut(s) 41
HpySE526I ACGT 1 cut(s) 16
Hsp92II CATG 2 cut(s) 110, 203
Kzo9I GATC 1 cut(s) 93
LpnPI CCDG 5 cut(s) 109, 136, 147, 196, 265
MaeII ACGT 1 cut(s) 16
MaeIII GTNAC 1 cut(s) 113
MalI GATC 1 cut(s) 95
MbiI CCGCTC 1 cut(s) 228
MboI GATC 1 cut(s) 93
MboII GAAGA 2 cut(s) 41, 215
MflI RGATCY 1 cut(s) 93
MhlI GDGCHC 1 cut(s) 225
MlsI TGGCCA 1 cut(s) 105
MluCI AATT 2 cut(s) 5, 322
MluNI TGGCCA 1 cut(s) 105
MlyI GAGTC 1 cut(s) 65
MnlI CCTC 1 cut(s) 59
Mox20I TGGCCA 1 cut(s) 105
MscI TGGCCA 1 cut(s) 105
MseI TTAA 1 cut(s) 78
MslI CAYNNNNRTG 2 cut(s) 204, 282
Msp20I TGGCCA 1 cut(s) 105
MspR9I CCNGG 1 cut(s) 124
MvaI CCWGG 1 cut(s) 124
MwoI GCNNNNNNNGC 1 cut(s) 41
NdeII GATC 1 cut(s) 93
NlaIII CATG 2 cut(s) 110, 203
NlaIV GGNNCC 1 cut(s) 181
NmuCI GTSAC 1 cut(s) 113
OliI CACNNNNGTG 1 cut(s) 282
PleI GAGTC 1 cut(s) 64
PpsI GAGTC 1 cut(s) 64
Ppu21I YACGTR 1 cut(s) 17
PshBI ATTAAT 1 cut(s) 78
Psp6I CCWGG 1 cut(s) 122
PspEI GGTNACC 1 cut(s) 113
PspGI CCWGG 1 cut(s) 122
PspN4I GGNNCC 1 cut(s) 181
PspPI GGNCC 1 cut(s) 179
PsuI RGATCY 1 cut(s) 93
RseI CAYNNNNRTG 2 cut(s) 204, 282
SaqAI TTAA 1 cut(s) 78
Sau3AI GATC 1 cut(s) 93
Sau96I GGNCC 1 cut(s) 179
SchI GAGTC 1 cut(s) 65
ScrFI CCNGG 1 cut(s) 124
SduI GDGCHC 1 cut(s) 225
SetI ASST 3 cut(s) 19, 70, 313
SmiMI CAYNNNNRTG 2 cut(s) 204, 282
SnaBI TACGTA 1 cut(s) 17
Sse9I AATT 2 cut(s) 5, 322
SsiI CCGC 2 cut(s) 42, 226
SspI AATATT 1 cut(s) 248
StyD4I CCNGG 1 cut(s) 122
TaiI ACGT 1 cut(s) 19
TaqI TCGA 1 cut(s) 70
TaqII GACCGA 1 cut(s) 101
TasI AATT 2 cut(s) 5, 322
Tru1I TTAA 1 cut(s) 78
Tru9I TTAA 1 cut(s) 78
TscAI CASTG 1 cut(s) 284
TseFI GTSAC 1 cut(s) 113
Tsp45I GTSAC 1 cut(s) 113
TspDTI ATGAA 1 cut(s) 216
TspRI CASTG 1 cut(s) 284
VspI ATTAAT 1 cut(s) 78
XmiI GTMKAC 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.