Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr2A

Orthogroup ID

OG0006927

Physical Location & Seq

Genomic Coordinates Reverse (-)

36538788 .. 36539264

Gene Structure 477 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh2AG295800.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 477 bp

ATGAGCACCGTCGTCAGCTTGCCGGAGAAGCGACAAGATCTCGGCCAGGGTCGGACCCCGGAGCAACCGCCGGAGAAGCGTCCGAAGCTTGATGATCCACAACTAGGAGAGGTCGACGATACTGCAATGGAATTGCAAAGTAATAGCAAATCAGAAGAAGCGAAGTCCGCAGAAGAAGTTAAGTCTACGGGAGGTCGAGACATTAATCCTTATTGTGAGATCTGTTATGGCCATGTCGGTCACCAATCCTGGGAATGTCCTGACAAATCAAAGGGAATGGGAATGGGTTGTTGTCTTTGTTATGGCCCCTGTAAAAAGAAAGATGATGGTGATGGTGAGCACTGGTCTATTGAAATGGTCAAATATTGTATCGTTTGTGGGTCTATGGGGAGGCACTGGGGTGATGACTGCCCCTATTGGTCTGAAGCTAAAGTGGATAATTCTGAGATAAGTGATGATGATTATGTTGCGTTCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

158

Amino Acids

17.59

Weight (kDa)

4.64

Isoelectric Point (pI)

46.66

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006927)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g03960
rosa_laevigata	RLG00000031143 RLG00000031144 RLG00000031145 RLG00000031146 RLG00000031147
rosa_multiflora	Rmu_sc0004279.1_g000016 Rmu_sc0004279.1_g000019 Rmu_sc0004279.1_g000021 Rmu_sc0004574.1_g000005 Rmu_sc0009787.1_g000006 Rmu_sc0013150.1_g000004
rosa_roxburghii	Rroxscaffold_1G00072450 Rroxscaffold_1G00072460 Rroxscaffold_1G00072470 Rroxscaffold_1G00072480
rosa_rugosa	Rorug04G0403900
rosa_samantha	Rh2AG295800 Rh2BG304800 Rh2DG319800 Rh5AG030700 Rh5CG032900 Rh5CG033200
rosa_wichuraiana	Rw2G023560 Rw5G002860 Rw5G002870

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	2 cut(s)	114, 185
AciI	CCGC	2 cut(s)	68, 168
AclWI	GGATC	1 cut(s)	89
AcoI	YGGCCR	2 cut(s)	43, 229
AcuI	CTGAAG	1 cut(s)	444
AfiI	CCNNNNNNNGG	2 cut(s)	104, 250
AgsI	TTSAA	1 cut(s)	353
AjnI	CCWGG	2 cut(s)	45, 248
AleI	CACNNNNGTG	1 cut(s)	399
AluBI	AGCT	3 cut(s)	18, 88, 428
AluI	AGCT	3 cut(s)	18, 88, 428
Alw21I	GWGCWC	2 cut(s)	8, 342
Alw26I	GTCTC	1 cut(s)	192
AlwI	GGATC	1 cut(s)	89
AoxI	GGCC	3 cut(s)	43, 229, 304
AseI	ATTAAT	1 cut(s)	204
AspS9I	GGNCC	2 cut(s)	54, 305
AsuC2I	CCSGG	1 cut(s)	59
AsuHPI	GGTGA	4 cut(s)	233, 341, 347, 413
AvaII	GGWCC	1 cut(s)	54
BalI	TGGCCA	1 cut(s)	231
Bbv12I	GWGCWC	2 cut(s)	8, 342
BccI	CCATC	2 cut(s)	320, 326
BcgI	CGANNNNNNTGC	2 cut(s)	104, 138
BciT130I	CCWGG	2 cut(s)	47, 250
BcnI	CCSGG	1 cut(s)	59
BcoDI	GTCTC	1 cut(s)	192
BfaI	CTAG	2 cut(s)	104, 475
BglII	AGATCT	2 cut(s)	37, 219
Bme1390I	CCNGG	3 cut(s)	47, 59, 250
Bme18I	GGWCC	1 cut(s)	54
BmgT120I	GGNCC	2 cut(s)	54, 305
BmiI	GGNNCC	2 cut(s)	56, 307
BmrFI	CCNGG	3 cut(s)	47, 59, 250
BmrI	ACTGGG	1 cut(s)	406
BmuI	ACTGGG	1 cut(s)	406
BpuMI	CCSGG	1 cut(s)	59
BsaJI	CCNNGG	3 cut(s)	46, 57, 249
Bsc4I	CCNNNNNNNGG	2 cut(s)	104, 250
Bse1I	ACTGG	2 cut(s)	347, 401
Bse3DI	GCAATG	1 cut(s)	132
BseBI	CCWGG	2 cut(s)	47, 250
BseDI	CCNNGG	3 cut(s)	46, 57, 249
BseLI	CCNNNNNNNGG	2 cut(s)	104, 250
BseMI	GCAATG	1 cut(s)	132
BseMII	CTCAG	1 cut(s)	435
BseNI	ACTGG	2 cut(s)	347, 401
BshFI	GGCC	3 cut(s)	45, 231, 306
BsiHKAI	GWGCWC	2 cut(s)	8, 342
BsiSI	CCGG	3 cut(s)	23, 59, 71
BslI	CCNNNNNNNGG	2 cut(s)	104, 250
BsmAI	GTCTC	1 cut(s)	192
BsnI	GGCC	3 cut(s)	45, 231, 306
Bsp1286I	GDGCHC	2 cut(s)	8, 342
Bsp143I	GATC	3 cut(s)	37, 94, 219
BspACI	CCGC	2 cut(s)	68, 168
BspANI	GGCC	3 cut(s)	45, 231, 306
BspCNI	CTCAG	1 cut(s)	436
BspLI	GGNNCC	2 cut(s)	56, 307
BspPI	GGATC	1 cut(s)	89
BsrDI	GCAATG	1 cut(s)	132
BsrI	ACTGG	2 cut(s)	347, 401
BssECI	CCNNGG	3 cut(s)	46, 57, 249
BssMI	GATC	3 cut(s)	37, 94, 219
Bst2UI	CCWGG	2 cut(s)	47, 250
Bst4CI	ACNGT	1 cut(s)	10
BstC8I	GCNNGC	1 cut(s)	20
BstDEI	CTNAG	1 cut(s)	444
BstEII	GGTNACC	1 cut(s)	239
BstKTI	GATC	3 cut(s)	40, 97, 222
BstMAI	GTCTC	1 cut(s)	192
BstMBI	GATC	3 cut(s)	37, 94, 219
BstMWI	GCNNNNNNNGC	4 cut(s)	28, 76, 85, 167
BstNI	CCWGG	2 cut(s)	47, 250
BstPI	GGTNACC	1 cut(s)	239
BstSCI	CCNGG	3 cut(s)	45, 57, 248
BstX2I	RGATCY	2 cut(s)	37, 219
BstYI	RGATCY	2 cut(s)	37, 219
BsuRI	GGCC	3 cut(s)	45, 231, 306
BtsIMutI	CAGTG	2 cut(s)	340, 394
Cac8I	GCNNGC	1 cut(s)	20
Cfr13I	GGNCC	2 cut(s)	54, 305
CseI	GACGC	1 cut(s)	68
CviAII	CATG	1 cut(s)	233
CviJI	RGCY	6 cut(s)	18, 45, 88, 231, 306, 428
CviKI_1	RGCY	6 cut(s)	18, 45, 88, 231, 306, 428
DdeI	CTNAG	1 cut(s)	444
DpnI	GATC	3 cut(s)	39, 96, 221
DpnII	GATC	3 cut(s)	37, 94, 219
EaeI	YGGCCR	2 cut(s)	43, 229
Eco47I	GGWCC	1 cut(s)	54
Eco57I	CTGAAG	1 cut(s)	444
Eco91I	GGTNACC	1 cut(s)	239
EcoO65I	GGTNACC	1 cut(s)	239
EcoRII	CCWGG	2 cut(s)	45, 248
FaeI	CATG	1 cut(s)	236
FaiI	YATR	5 cut(s)	228, 234, 303, 386, 465
FatI	CATG	1 cut(s)	232
FblI	GTMKAC	2 cut(s)	114, 185
FspBI	CTAG	2 cut(s)	104, 475
HaeIII	GGCC	3 cut(s)	45, 231, 306
HapII	CCGG	3 cut(s)	23, 59, 71
HgaI	GACGC	1 cut(s)	68
Hin1II	CATG	1 cut(s)	236
HincII	GTYRAC	1 cut(s)	115
HindII	GTYRAC	1 cut(s)	115
HindIII	AAGCTT	1 cut(s)	86
HpaII	CCGG	3 cut(s)	23, 59, 71
HphI	GGTGA	4 cut(s)	233, 341, 347, 413
Hpy166II	GTNNAC	2 cut(s)	115, 186
Hpy188I	TCNGA	5 cut(s)	54, 84, 154, 424, 445
Hpy188III	TCNNGA	2 cut(s)	197, 260
Hpy8I	GTNNAC	2 cut(s)	115, 186
Hpy99I	CGWCG	2 cut(s)	14, 119
HpyCH4III	ACNGT	1 cut(s)	10
HpyCH4V	TGCA	2 cut(s)	125, 136
HpyF10VI	GCNNNNNNNGC	4 cut(s)	28, 76, 85, 167
HpyF3I	CTNAG	1 cut(s)	444
Hsp92II	CATG	1 cut(s)	236
Kzo9I	GATC	3 cut(s)	37, 94, 219
LmnI	GCTCC	1 cut(s)	61
MaeI	CTAG	2 cut(s)	104, 475
MaeIII	GTNAC	1 cut(s)	239
MalI	GATC	3 cut(s)	39, 96, 221
MboI	GATC	3 cut(s)	37, 94, 219
MboII	GAAGA	2 cut(s)	167, 185
MflI	RGATCY	2 cut(s)	37, 219
MhlI	GDGCHC	2 cut(s)	8, 342
MlsI	TGGCCA	1 cut(s)	231
MluCI	AATT	2 cut(s)	131, 439
MluNI	TGGCCA	1 cut(s)	231
MmeI	TCCRAC	1 cut(s)	32
MnlI	CCTC	3 cut(s)	103, 185, 384
Mox20I	TGGCCA	1 cut(s)	231
MscI	TGGCCA	1 cut(s)	231
MseI	TTAA	2 cut(s)	180, 204
MslI	CAYNNNNRTG	1 cut(s)	399
Msp20I	TGGCCA	1 cut(s)	231
MspI	CCGG	3 cut(s)	23, 59, 71
MspR9I	CCNGG	3 cut(s)	47, 59, 250
MvaI	CCWGG	2 cut(s)	47, 250
MwoI	GCNNNNNNNGC	4 cut(s)	28, 76, 85, 167
NciI	CCSGG	1 cut(s)	59
NdeII	GATC	3 cut(s)	37, 94, 219
NlaIII	CATG	1 cut(s)	236
NlaIV	GGNNCC	2 cut(s)	56, 307
NmeAIII	GCCGAG	1 cut(s)	21
NmuCI	GTSAC	1 cut(s)	239
OliI	CACNNNNGTG	1 cut(s)	399
PshBI	ATTAAT	1 cut(s)	204
Psp6I	CCWGG	2 cut(s)	45, 248
PspEI	GGTNACC	1 cut(s)	239
PspGI	CCWGG	2 cut(s)	45, 248
PspN4I	GGNNCC	2 cut(s)	56, 307
PspPI	GGNCC	2 cut(s)	54, 305
PsuI	RGATCY	2 cut(s)	37, 219
RseI	CAYNNNNRTG	1 cut(s)	399
SalI	GTCGAC	1 cut(s)	113
SaqAI	TTAA	2 cut(s)	180, 204
Sau3AI	GATC	3 cut(s)	37, 94, 219
Sau96I	GGNCC	2 cut(s)	54, 305
ScrFI	CCNGG	3 cut(s)	47, 59, 250
SduI	GDGCHC	2 cut(s)	8, 342
SetI	ASST	5 cut(s)	20, 90, 114, 196, 430
SinI	GGWCC	1 cut(s)	54
SmiMI	CAYNNNNRTG	1 cut(s)	399
Sse9I	AATT	2 cut(s)	131, 439
SsiI	CCGC	2 cut(s)	68, 168
SspI	AATATT	1 cut(s)	365
SspMI	CTAG	2 cut(s)	104, 475
StyD4I	CCNGG	3 cut(s)	45, 57, 248
TaaI	ACNGT	1 cut(s)	10
TaqI	TCGA	2 cut(s)	114, 196
TaqII	GACCGA	1 cut(s)	227
TasI	AATT	2 cut(s)	131, 439
Tru1I	TTAA	2 cut(s)	180, 204
Tru9I	TTAA	2 cut(s)	180, 204
TscAI	CASTG	2 cut(s)	347, 401
TseFI	GTSAC	1 cut(s)	239
Tsp45I	GTSAC	1 cut(s)	239
TspRI	CASTG	2 cut(s)	347, 401
VpaK11BI	GGWCC	1 cut(s)	54
VspI	ATTAAT	1 cut(s)	204
XmiI	GTMKAC	2 cut(s)	114, 185
XspI	CTAG	2 cut(s)	104, 475

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.