Rmu_co8327627.1_g000001
MYB Family

Myb/SANT-like DNA-binding domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8327627.1
Physical Location & Seq
Reverse (-)
1 .. 917
917 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8327627.1_g000001.1.cds

Sequence Viewer

Length: 714 bp
atggctgaaattcaaggagggaacagtggcagttttgtaatgagggactacaggaaagggaactggacagtgggggagacaatggttctgattgaggcaaagaagatggatgaggagagaagaataatgaagagaagtggtagtggtagtggggatcatggggctgatcagacccccagatcaataagcaaaccagctgagctgagatggaaatgggtggaagactattgctggaagaaagggtgcttgagaagccaaaaccagtgcaatgacaagtgggacaatctcatgagggactacaagaaagtgagggagtatgagaagagaagtgtaggggtgggagagaataaggagttggcatcttactggaagcttgagaagagtgagaggaaggagaggaacttgcccacaaatatggtgcctcagatttatgagtctttggttgaggtggtggagaagagagagatgggtagaattgtagtcggtggtggtggtgcttctgtttctgggtccattagtcccaaccccaacattggatatgcggtggagagacccataattagtggcatccatcagtctacagtgctctctcctcctcctgtgctgcaacagcacctgatccaaccacaaccaatttcagcaatgcatcttttaccagcaccattggcagctcaaccaccacctcctcttccatattctcaacctattccccca
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

238

Amino Acids

26.72

Weight (kDa)

9.17

Isoelectric Point (pI)

60.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 418
AccI GTMKAC 1 cut(s) 578
AciI CCGC 1 cut(s) 542
AclWI GGATC 2 cut(s) 162, 613
AcsI RAATTY 1 cut(s) 9
AfiI CCNNNNNNNGG 1 cut(s) 533
AgsI TTSAA 1 cut(s) 14
AjuI GAANNNNNNNTTGG 2 cut(s) 338, 370
AluBI AGCT 4 cut(s) 197, 202, 373, 671
AluI AGCT 4 cut(s) 197, 202, 373, 671
Alw21I GWGCWC 1 cut(s) 588
Alw26I GTCTC 2 cut(s) 71, 544
AlwI GGATC 2 cut(s) 162, 613
AlwNI CAGNNNCTG 1 cut(s) 616
ApeKI GCWGC 2 cut(s) 604, 668
ApoI RAATTY 1 cut(s) 9
AspS9I GGNCC 1 cut(s) 510
AvaII GGWCC 1 cut(s) 510
BanI GGYRCC 1 cut(s) 418
BbsI GAAGAC 1 cut(s) 228
Bbv12I GWGCWC 1 cut(s) 588
BbvI GCAGC 2 cut(s) 591, 680
BccI CCATC 4 cut(s) 100, 201, 460, 579
BclI TGATCA 1 cut(s) 166
BcoDI GTCTC 2 cut(s) 71, 544
BfmI CTRYAG 2 cut(s) 49, 579
BisI GCNGC 2 cut(s) 605, 669
BlpI GCTNAGC 1 cut(s) 198
BlsI GCNGC 2 cut(s) 606, 670
Bme18I GGWCC 1 cut(s) 510
BmgT120I GGNCC 1 cut(s) 510
BmiI GGNNCC 2 cut(s) 420, 511
BmsI GCATC 3 cut(s) 368, 576, 655
BpiI GAAGAC 1 cut(s) 228
Bpu1102I GCTNAGC 1 cut(s) 198
BpuEI CTTGAG 2 cut(s) 268, 395
BsaI GGTCTC 1 cut(s) 544
Bsc4I CCNNNNNNNGG 1 cut(s) 533
Bse1I ACTGG 3 cut(s) 68, 262, 371
Bse3DI GCAATG 2 cut(s) 274, 648
BseGI GGATG 2 cut(s) 115, 567
BseLI CCNNNNNNNGG 1 cut(s) 533
BseMI GCAATG 2 cut(s) 274, 648
BseMII CTCAG 3 cut(s) 189, 194, 437
BseNI ACTGG 3 cut(s) 68, 262, 371
BseRI GAGGAG 4 cut(s) 128, 582, 585, 675
BseXI GCAGC 2 cut(s) 591, 680
BshNI GGYRCC 1 cut(s) 418
BsiHKAI GWGCWC 1 cut(s) 588
BslFI GGGAC 4 cut(s) 59, 293, 308, 504
BslI CCNNNNNNNGG 1 cut(s) 533
BsmAI GTCTC 2 cut(s) 71, 544
BsmFI GGGAC 4 cut(s) 59, 293, 308, 504
Bso31I GGTCTC 1 cut(s) 544
Bsp1286I GDGCHC 1 cut(s) 588
Bsp143I GATC 4 cut(s) 154, 166, 179, 618
Bsp1720I GCTNAGC 1 cut(s) 198
BspACI CCGC 1 cut(s) 542
BspCNI CTCAG 3 cut(s) 190, 195, 436
BspHI TCATGA 1 cut(s) 288
BspLI GGNNCC 2 cut(s) 420, 511
BspPI GGATC 2 cut(s) 162, 613
BspT107I GGYRCC 1 cut(s) 418
BspTNI GGTCTC 1 cut(s) 544
BsrDI GCAATG 2 cut(s) 274, 648
BsrI ACTGG 3 cut(s) 68, 262, 371
BssMI GATC 4 cut(s) 154, 166, 179, 618
Bst4CI ACNGT 3 cut(s) 26, 70, 583
Bst6I CTCTTC 5 cut(s) 125, 317, 374, 452, 693
BstDEI CTNAG 3 cut(s) 198, 203, 423
BstF5I GGATG 2 cut(s) 115, 567
BstKTI GATC 4 cut(s) 157, 169, 182, 621
BstMAI GTCTC 2 cut(s) 71, 544
BstMBI GATC 4 cut(s) 154, 166, 179, 618
BstMWI GCNNNNNNNGC 3 cut(s) 252, 610, 665
BstSFI CTRYAG 2 cut(s) 49, 579
BstV1I GCAGC 2 cut(s) 591, 680
BstV2I GAAGAC 1 cut(s) 228
BstXI CCANNNNNNTGG 1 cut(s) 415
BtsCI GGATG 2 cut(s) 115, 567
BtsIMutI CAGTG 4 cut(s) 31, 75, 269, 588
CaiI CAGNNNCTG 1 cut(s) 616
CciI TCATGA 1 cut(s) 288
Cfr13I GGNCC 1 cut(s) 510
CviAII CATG 2 cut(s) 158, 289
CviJI RGCY 7 cut(s) 5, 164, 197, 202, 255, 373, 671
CviKI_1 RGCY 7 cut(s) 5, 164, 197, 202, 255, 373, 671
DdeI CTNAG 3 cut(s) 198, 203, 423
DpnI GATC 4 cut(s) 156, 168, 181, 620
DpnII GATC 4 cut(s) 154, 166, 179, 618
Eam1104I CTCTTC 5 cut(s) 125, 317, 374, 452, 693
EarI CTCTTC 5 cut(s) 125, 317, 374, 452, 693
Eco31I GGTCTC 1 cut(s) 544
Eco47I GGWCC 1 cut(s) 510
EcoT22I ATGCAT 1 cut(s) 648
FaeI CATG 2 cut(s) 161, 292
FaiI YATR 8 cut(s) 159, 290, 318, 416, 432, 540, 557, 694
FaqI GGGAC 4 cut(s) 59, 293, 308, 504
FatI CATG 2 cut(s) 157, 288
FbaI TGATCA 1 cut(s) 166
FblI GTMKAC 1 cut(s) 578
Fnu4HI GCNGC 2 cut(s) 605, 669
FokI GGATG 2 cut(s) 122, 554
Fsp4HI GCNGC 2 cut(s) 605, 669
GluI GCNGC 2 cut(s) 605, 669
Hin1II CATG 2 cut(s) 161, 292
HindIII AAGCTT 1 cut(s) 371
HinfI GANTC 1 cut(s) 434
Hpy166II GTNNAC 1 cut(s) 579
Hpy188I TCNGA 3 cut(s) 90, 171, 426
Hpy188III TCNNGA 1 cut(s) 289
Hpy8I GTNNAC 1 cut(s) 579
HpyAV CCTTC 1 cut(s) 385
HpyCH4III ACNGT 3 cut(s) 26, 70, 583
HpyCH4V TGCA 3 cut(s) 267, 607, 646
HpyF10VI GCNNNNNNNGC 3 cut(s) 252, 610, 665
HpyF3I CTNAG 3 cut(s) 198, 203, 423
Hsp92II CATG 2 cut(s) 161, 292
Ksp22I TGATCA 1 cut(s) 166
Kzo9I GATC 4 cut(s) 154, 166, 179, 618
Lsp1109I GCAGC 2 cut(s) 591, 680
LweI GCATC 3 cut(s) 368, 576, 655
MalI GATC 4 cut(s) 156, 168, 181, 620
MboI GATC 4 cut(s) 154, 166, 179, 618
MboII GAAGA 9 cut(s) 115, 132, 142, 233, 247, 334, 391, 469, 680
MhlI GDGCHC 1 cut(s) 588
MluCI AATT 4 cut(s) 9, 474, 558, 633
MlyI GAGTC 1 cut(s) 443
MmeI TCCRAC 1 cut(s) 646
Mph1103I ATGCAT 1 cut(s) 648
MslI CAYNNNNRTG 1 cut(s) 413
MspA1I CMGCKG 1 cut(s) 197
MwoI GCNNNNNNNGC 3 cut(s) 252, 610, 665
NdeII GATC 4 cut(s) 154, 166, 179, 618
NlaIII CATG 2 cut(s) 161, 292
NlaIV GGNNCC 2 cut(s) 420, 511
NsiI ATGCAT 1 cut(s) 648
PagI TCATGA 1 cut(s) 288
PkrI GCNGC 2 cut(s) 606, 670
PleI GAGTC 1 cut(s) 442
PpsI GAGTC 1 cut(s) 442
PspN4I GGNNCC 2 cut(s) 420, 511
PspPI GGNCC 1 cut(s) 510
PstNI CAGNNNCTG 1 cut(s) 616
PvuII CAGCTG 1 cut(s) 197
RseI CAYNNNNRTG 1 cut(s) 413
SatI GCNGC 2 cut(s) 605, 669
Sau3AI GATC 4 cut(s) 154, 166, 179, 618
Sau96I GGNCC 1 cut(s) 510
SchI GAGTC 1 cut(s) 443
SduI GDGCHC 1 cut(s) 588
SetI ASST 8 cut(s) 199, 204, 375, 450, 618, 673, 685, 706
SfaNI GCATC 3 cut(s) 368, 576, 655
SfcI CTRYAG 2 cut(s) 49, 579
SinI GGWCC 1 cut(s) 510
SmiMI CAYNNNNRTG 1 cut(s) 413
SmlI CTYRAG 2 cut(s) 247, 374
SmoI CTYRAG 2 cut(s) 247, 374
Sse9I AATT 4 cut(s) 9, 474, 558, 633
SsiI CCGC 1 cut(s) 542
TaaI ACNGT 3 cut(s) 26, 70, 583
TasI AATT 4 cut(s) 9, 474, 558, 633
TscAI CASTG 4 cut(s) 31, 75, 269, 588
TseI GCWGC 2 cut(s) 604, 668
TspDTI ATGAA 1 cut(s) 143
TspRI CASTG 4 cut(s) 31, 75, 269, 588
VpaK11BI GGWCC 1 cut(s) 510
XapI RAATTY 1 cut(s) 9
XmiI GTMKAC 1 cut(s) 578
Zsp2I ATGCAT 1 cut(s) 648
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.