Rh7DG176500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
16184005 .. 16184383
379 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG176500.1

Sequence Viewer

Length: 192 bp
ATGAAAGTCAAAAGGGAACAAATAGATGAGGCTATTGTGCATTCAGACAGGAAATTTGAGGACGAGTCGTGGCCATTAACTGAAGCCAATTGTGACTCGCCTGTTTTGGAGCCAAGCTCTCTTGGTATGGAGAACCAGTGGTCCAACCAGGCGATCACCAAGATGCTGGACAGAGAAAGAGGTCAATACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.37

Weight (kDa)

4.67

Isoelectric Point (pI)

46.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 71
AcsI RAATTY 1 cut(s) 53
AcuI CTGAAG 1 cut(s) 102
AjnI CCWGG 1 cut(s) 147
AloI GAACNNNNNNTCC 2 cut(s) 125, 157
AluBI AGCT 1 cut(s) 117
AluI AGCT 1 cut(s) 117
AoxI GGCC 1 cut(s) 71
ApoI RAATTY 1 cut(s) 53
ArsI GACNNNNNNTTYG 2 cut(s) 38, 70
AspS9I GGNCC 1 cut(s) 141
AsuHPI GGTGA 1 cut(s) 148
AvaII GGWCC 1 cut(s) 141
BalI TGGCCA 1 cut(s) 73
BciT130I CCWGG 1 cut(s) 149
Bme1390I CCNGG 1 cut(s) 149
Bme18I GGWCC 1 cut(s) 141
BmgT120I GGNCC 1 cut(s) 141
BmiI GGNNCC 1 cut(s) 111
BmrFI CCNGG 1 cut(s) 149
BmsI GCATC 1 cut(s) 153
BplI GAGNNNNNCTC 2 cut(s) 101, 133
BsaXI ACNNNNNCTCC 2 cut(s) 122, 152
Bse1I ACTGG 1 cut(s) 136
BseBI CCWGG 1 cut(s) 149
BseNI ACTGG 1 cut(s) 136
BshFI GGCC 1 cut(s) 73
BsmI GAATGC 1 cut(s) 40
BsnI GGCC 1 cut(s) 73
Bsp143I GATC 1 cut(s) 153
BspANI GGCC 1 cut(s) 73
BspLI GGNNCC 1 cut(s) 111
BsrI ACTGG 1 cut(s) 136
BssMI GATC 1 cut(s) 153
Bst2UI CCWGG 1 cut(s) 149
BstKTI GATC 1 cut(s) 156
BstMBI GATC 1 cut(s) 153
BstNI CCWGG 1 cut(s) 149
BstSCI CCNGG 1 cut(s) 147
BstXI CCANNNNNNTGG 1 cut(s) 166
BsuRI GGCC 1 cut(s) 73
BtsIMutI CAGTG 1 cut(s) 143
Cfr13I GGNCC 1 cut(s) 141
CviJI RGCY 5 cut(s) 32, 73, 86, 112, 117
CviKI_1 RGCY 5 cut(s) 32, 73, 86, 112, 117
DpnI GATC 1 cut(s) 155
DpnII GATC 1 cut(s) 153
EaeI YGGCCR 1 cut(s) 71
Eco47I GGWCC 1 cut(s) 141
Eco57I CTGAAG 1 cut(s) 102
EcoRII CCWGG 1 cut(s) 147
FaiI YATR 1 cut(s) 128
HaeIII GGCC 1 cut(s) 73
HinfI GANTC 2 cut(s) 65, 95
HphI GGTGA 1 cut(s) 148
Hpy188I TCNGA 1 cut(s) 46
HpyCH4V TGCA 1 cut(s) 40
Kzo9I GATC 1 cut(s) 153
LmnI GCTCC 1 cut(s) 109
LpnPI CCDG 6 cut(s) 34, 114, 134, 149, 152, 161
LweI GCATC 1 cut(s) 153
MaeIII GTNAC 1 cut(s) 92
MalI GATC 1 cut(s) 155
MboI GATC 1 cut(s) 153
MfeI CAATTG 1 cut(s) 88
MlsI TGGCCA 1 cut(s) 73
MluCI AATT 2 cut(s) 53, 88
MluNI TGGCCA 1 cut(s) 73
MlyI GAGTC 2 cut(s) 74, 89
MmeI TCCRAC 1 cut(s) 168
MnlI CCTC 3 cut(s) 22, 52, 173
Mox20I TGGCCA 1 cut(s) 73
MscI TGGCCA 1 cut(s) 73
MseI TTAA 1 cut(s) 77
MslI CAYNNNNRTG 1 cut(s) 161
Msp20I TGGCCA 1 cut(s) 73
MspR9I CCNGG 1 cut(s) 149
MunI CAATTG 1 cut(s) 88
Mva1269I GAATGC 1 cut(s) 40
MvaI CCWGG 1 cut(s) 149
NdeII GATC 1 cut(s) 153
NlaIV GGNNCC 1 cut(s) 111
NmuCI GTSAC 1 cut(s) 92
PctI GAATGC 1 cut(s) 40
PleI GAGTC 2 cut(s) 73, 89
PpsI GAGTC 2 cut(s) 73, 89
Psp6I CCWGG 1 cut(s) 147
PspGI CCWGG 1 cut(s) 147
PspN4I GGNNCC 1 cut(s) 111
PspPI GGNCC 1 cut(s) 141
RseI CAYNNNNRTG 1 cut(s) 161
SaqAI TTAA 1 cut(s) 77
Sau3AI GATC 1 cut(s) 153
Sau96I GGNCC 1 cut(s) 141
SchI GAGTC 2 cut(s) 74, 89
ScrFI CCNGG 1 cut(s) 149
SetI ASST 2 cut(s) 119, 184
SfaNI GCATC 1 cut(s) 153
SinI GGWCC 1 cut(s) 141
SmiMI CAYNNNNRTG 1 cut(s) 161
Sse9I AATT 2 cut(s) 53, 88
StyD4I CCNGG 1 cut(s) 147
TasI AATT 2 cut(s) 53, 88
Tru1I TTAA 1 cut(s) 77
Tru9I TTAA 1 cut(s) 77
TscAI CASTG 1 cut(s) 143
TseFI GTSAC 1 cut(s) 92
Tsp45I GTSAC 1 cut(s) 92
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 143
VpaK11BI GGWCC 1 cut(s) 141
XapI RAATTY 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.