Rroxscaffold_7G00170870

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
11265683 .. 11268038
2356 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00170870.1

Sequence Viewer

Length: 165 bp
ATGCCCCAAACCCAAAGCATTCCCGGACCCCGCCTTCTTCAACCTCCTTTCGTACTTGATCAATCCGAGTATCGCAAGTTTCGGGAGGTGGGAATTAGTCCTAAAATGATGGCTGTTCATGACAACATGTTCAGGGGTAGCACAGCCCTAGGTCATTTGTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

6.1

Weight (kDa)

9.69

Isoelectric Point (pI)

62.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 31
AfaI GTAC 1 cut(s) 54
AflIII ACRYGT 1 cut(s) 126
AgsI TTSAA 1 cut(s) 41
AspA2I CCTAGG 1 cut(s) 148
AspS9I GGNCC 1 cut(s) 26
AsuC2I CCSGG 1 cut(s) 24
AvaII GGWCC 1 cut(s) 26
AvrII CCTAGG 1 cut(s) 148
BccI CCATC 1 cut(s) 103
BclI TGATCA 1 cut(s) 58
BcnI CCSGG 1 cut(s) 24
BfaI CTAG 1 cut(s) 149
BlnI CCTAGG 1 cut(s) 148
Bme1390I CCNGG 1 cut(s) 24
Bme18I GGWCC 1 cut(s) 26
BmgT120I GGNCC 1 cut(s) 26
BmiI GGNNCC 1 cut(s) 28
BmrFI CCNGG 1 cut(s) 24
BpuMI CCSGG 1 cut(s) 24
BsaJI CCNNGG 1 cut(s) 148
BseDI CCNNGG 1 cut(s) 148
BsiSI CCGG 1 cut(s) 24
BsmI GAATGC 1 cut(s) 18
Bsp143I GATC 1 cut(s) 58
BspACI CCGC 1 cut(s) 31
BspHI TCATGA 2 cut(s) 118, 161
BspLI GGNNCC 1 cut(s) 28
BssECI CCNNGG 1 cut(s) 148
BssMI GATC 1 cut(s) 58
BssT1I CCWWGG 1 cut(s) 148
BstKTI GATC 1 cut(s) 61
BstMBI GATC 1 cut(s) 58
BstNSI RCATGY 1 cut(s) 130
BstSCI CCNGG 1 cut(s) 22
CciI TCATGA 2 cut(s) 118, 161
Cfr13I GGNCC 1 cut(s) 26
Csp6I GTAC 1 cut(s) 53
CviAII CATG 3 cut(s) 119, 127, 162
CviJI RGCY 2 cut(s) 113, 146
CviKI_1 RGCY 2 cut(s) 113, 146
CviQI GTAC 1 cut(s) 53
DpnI GATC 1 cut(s) 60
DpnII GATC 1 cut(s) 58
Eco130I CCWWGG 1 cut(s) 148
Eco47I GGWCC 1 cut(s) 26
EcoT14I CCWWGG 1 cut(s) 148
ErhI CCWWGG 1 cut(s) 148
FaeI CATG 3 cut(s) 122, 130, 165
FaiI YATR 3 cut(s) 120, 128, 163
FatI CATG 3 cut(s) 118, 126, 161
FauI CCCGC 1 cut(s) 38
FbaI TGATCA 1 cut(s) 58
FspBI CTAG 1 cut(s) 149
HapII CCGG 1 cut(s) 24
Hin1II CATG 3 cut(s) 122, 130, 165
HpaII CCGG 1 cut(s) 24
Hpy188I TCNGA 1 cut(s) 67
Hpy188III TCNNGA 3 cut(s) 83, 119, 162
HpyAV CCTTC 1 cut(s) 44
Hsp92II CATG 3 cut(s) 122, 130, 165
Ksp22I TGATCA 1 cut(s) 58
Kzo9I GATC 1 cut(s) 58
LpnPI CCDG 2 cut(s) 37, 118
MaeI CTAG 1 cut(s) 149
MalI GATC 1 cut(s) 60
MboI GATC 1 cut(s) 58
MboII GAAGA 1 cut(s) 29
MluCI AATT 1 cut(s) 93
MnlI CCTC 2 cut(s) 54, 79
MspI CCGG 1 cut(s) 24
MspR9I CCNGG 1 cut(s) 24
Mva1269I GAATGC 1 cut(s) 18
NciI CCSGG 1 cut(s) 24
NdeII GATC 1 cut(s) 58
NlaIII CATG 3 cut(s) 122, 130, 165
NlaIV GGNNCC 1 cut(s) 28
NspI RCATGY 1 cut(s) 130
PagI TCATGA 2 cut(s) 118, 161
PciI ACATGT 1 cut(s) 126
PctI GAATGC 1 cut(s) 18
PfoI TCCNGGA 1 cut(s) 22
PscI ACATGT 1 cut(s) 126
PspN4I GGNNCC 1 cut(s) 28
PspPI GGNCC 1 cut(s) 26
RsaI GTAC 1 cut(s) 54
RsaNI GTAC 1 cut(s) 53
Sau3AI GATC 1 cut(s) 58
Sau96I GGNCC 1 cut(s) 26
ScrFI CCNGG 1 cut(s) 24
SetI ASST 3 cut(s) 46, 90, 154
SinI GGWCC 1 cut(s) 26
Sse9I AATT 1 cut(s) 93
SsiI CCGC 1 cut(s) 31
SspMI CTAG 1 cut(s) 149
StyD4I CCNGG 1 cut(s) 22
StyI CCWWGG 1 cut(s) 148
TasI AATT 1 cut(s) 93
TspDTI ATGAA 1 cut(s) 107
VpaK11BI GGWCC 1 cut(s) 26
XceI RCATGY 1 cut(s) 130
XmaJI CCTAGG 1 cut(s) 148
XspI CTAG 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.