Rroxscaffold_7G00157020
MYB Family

Bromodomain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0012704
Physical Location & Seq
Reverse (-)
866065 .. 868386
2322 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00157020.1

Sequence Viewer

Length: 180 bp
ATGGTCGACAAGCTCCGCAAGCTCCGAGTCGAGGAGCTCCTGCGCGAGGTCCGCCGTCGAGACATTTCGATCATGAGTCGATGCAGTTGCAAAATTGATAAGAAGCTAACATACTCTTCAAAATATCTAAGAAGTCAGGATATAGAGTTTGCTAAAGATGATACATTTCCAACAGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Bromodomain Myb_DNA-binding

Protein Analysis

59

Amino Acids

7.13

Weight (kDa)

9.34

Isoelectric Point (pI)

80.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 6
AccII CGCG 1 cut(s) 45
AciI CCGC 2 cut(s) 16, 52
AfiI CCNNNNNNNGG 2 cut(s) 31, 46
AgsI TTSAA 1 cut(s) 120
AluBI AGCT 4 cut(s) 13, 22, 37, 106
AluI AGCT 4 cut(s) 13, 22, 37, 106
Alw21I GWGCWC 1 cut(s) 39
Alw26I GTCTC 1 cut(s) 54
AspLEI GCGC 1 cut(s) 45
AspS9I GGNCC 1 cut(s) 49
AvaII GGWCC 1 cut(s) 49
BanII GRGCYC 1 cut(s) 39
BarI GAAGNNNNNNTAC 2 cut(s) 95, 127
Bbv12I GWGCWC 1 cut(s) 39
BceAI ACGGC 1 cut(s) 39
BcgI CGANNNNNNTGC 2 cut(s) 69, 103
BcoDI GTCTC 1 cut(s) 54
Bme18I GGWCC 1 cut(s) 49
BmgT120I GGNCC 1 cut(s) 49
BmsI GCATC 1 cut(s) 71
Bsc4I CCNNNNNNNGG 2 cut(s) 31, 46
BseLI CCNNNNNNNGG 2 cut(s) 31, 46
BseRI GAGGAG 1 cut(s) 47
Bsh1236I CGCG 1 cut(s) 45
BsiHKAI GWGCWC 1 cut(s) 39
BslI CCNNNNNNNGG 2 cut(s) 31, 46
BsmAI GTCTC 1 cut(s) 54
Bsp1286I GDGCHC 1 cut(s) 39
Bsp143I GATC 1 cut(s) 69
BspACI CCGC 2 cut(s) 16, 52
BspFNI CGCG 1 cut(s) 45
BspHI TCATGA 1 cut(s) 72
BssMI GATC 1 cut(s) 69
Bst6I CTCTTC 1 cut(s) 121
BstC8I GCNNGC 1 cut(s) 20
BstDEI CTNAG 1 cut(s) 128
BstENI CCTNNNNNAGG 1 cut(s) 44
BstFNI CGCG 1 cut(s) 45
BstHHI GCGC 1 cut(s) 45
BstKTI GATC 1 cut(s) 72
BstMAI GTCTC 1 cut(s) 54
BstMBI GATC 1 cut(s) 69
BstMWI GCNNNNNNNGC 2 cut(s) 19, 51
BstUI CGCG 1 cut(s) 45
Cac8I GCNNGC 1 cut(s) 20
CciI TCATGA 1 cut(s) 72
CfoI GCGC 1 cut(s) 45
Cfr13I GGNCC 1 cut(s) 49
CviAII CATG 1 cut(s) 73
CviJI RGCY 4 cut(s) 13, 22, 37, 106
CviKI_1 RGCY 4 cut(s) 13, 22, 37, 106
DdeI CTNAG 1 cut(s) 128
DpnI GATC 1 cut(s) 71
DpnII GATC 1 cut(s) 69
Eam1104I CTCTTC 1 cut(s) 121
EarI CTCTTC 1 cut(s) 121
EciI GGCGGA 1 cut(s) 41
Ecl136II GAGCTC 1 cut(s) 37
Eco24I GRGCYC 1 cut(s) 39
Eco47I GGWCC 1 cut(s) 49
Eco53kI GAGCTC 1 cut(s) 37
EcoICRI GAGCTC 1 cut(s) 37
EcoNI CCTNNNNNAGG 1 cut(s) 44
EcoT38I GRGCYC 1 cut(s) 39
FaeI CATG 1 cut(s) 76
FaiI YATR 3 cut(s) 74, 112, 143
FatI CATG 1 cut(s) 72
FblI GTMKAC 1 cut(s) 6
FriOI GRGCYC 1 cut(s) 39
FspEI CC 8 cut(s) 17, 29, 32, 38, 53, 65, 68, 122
GlaI GCGC 1 cut(s) 44
HhaI GCGC 1 cut(s) 45
Hin1II CATG 1 cut(s) 76
Hin6I GCGC 1 cut(s) 43
HinP1I GCGC 1 cut(s) 43
HincII GTYRAC 1 cut(s) 7
HindII GTYRAC 1 cut(s) 7
HinfI GANTC 2 cut(s) 27, 76
Hpy166II GTNNAC 1 cut(s) 7
Hpy188I TCNGA 1 cut(s) 26
Hpy188III TCNNGA 3 cut(s) 59, 73, 137
Hpy8I GTNNAC 1 cut(s) 7
Hpy99I CGWCG 1 cut(s) 60
HpyCH4V TGCA 2 cut(s) 84, 90
HpyF10VI GCNNNNNNNGC 2 cut(s) 19, 51
HpyF3I CTNAG 1 cut(s) 128
Hsp92II CATG 1 cut(s) 76
HspAI GCGC 1 cut(s) 43
Kzo9I GATC 1 cut(s) 69
LmnI GCTCC 4 cut(s) 18, 27, 34, 42
LpnPI CCDG 2 cut(s) 53, 122
LweI GCATC 1 cut(s) 71
MalI GATC 1 cut(s) 71
MboI GATC 1 cut(s) 69
MboII GAAGA 1 cut(s) 108
MhlI GDGCHC 1 cut(s) 39
MluCI AATT 1 cut(s) 93
MlyI GAGTC 2 cut(s) 36, 85
MnlI CCTC 2 cut(s) 25, 40
MvnI CGCG 1 cut(s) 45
MwoI GCNNNNNNNGC 2 cut(s) 19, 51
NdeII GATC 1 cut(s) 69
NlaIII CATG 1 cut(s) 76
PagI TCATGA 1 cut(s) 72
PleI GAGTC 2 cut(s) 35, 84
PpsI GAGTC 2 cut(s) 35, 84
Psp124BI GAGCTC 1 cut(s) 39
PspPI GGNCC 1 cut(s) 49
SacI GAGCTC 1 cut(s) 39
SalI GTCGAC 1 cut(s) 5
Sau3AI GATC 1 cut(s) 69
Sau96I GGNCC 1 cut(s) 49
SchI GAGTC 2 cut(s) 36, 85
SduI GDGCHC 1 cut(s) 39
SetI ASST 5 cut(s) 15, 24, 39, 51, 108
SfaNI GCATC 1 cut(s) 71
SinI GGWCC 1 cut(s) 49
Sse9I AATT 1 cut(s) 93
SsiI CCGC 2 cut(s) 16, 52
SstI GAGCTC 1 cut(s) 39
TaqI TCGA 5 cut(s) 6, 30, 58, 68, 79
TasI AATT 1 cut(s) 93
VpaK11BI GGWCC 1 cut(s) 49
XagI CCTNNNNNAGG 1 cut(s) 44
XmiI GTMKAC 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.