Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0019861.1

Orthogroup ID

OG0017024

Physical Location & Seq

Genomic Coordinates Forward (+)

2289 .. 3459

Gene Structure 1171 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0019861.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 597 bp

atggaaccaccagaaccggccaaaaaaccaccgaaccggccaccggaagtatcgaaccagccctccaagaagaaaaaaagggatccctgcactggttcaccacctctcggacctccgattgctaccaaatttttccaccaacagcacctcgatcccaggatccaggaaccaaaaacagaactcaaaaaaccgcacagggacccactaccacgtgagcacaggtcaacgctggttaactccgatcaacgccagttgaccttttctaatcaactttccagcaacttgtccaggcactttttcaggatgagtaacctgaacaaattggactttgctccattgggaacaactggctctggatatcacaggtgggttcgtgatgtccgccagcatctcaaggccgatggaatcttggatacgattctcgtgcctagccaggacgtgttaattgttgagcaagcacaagctttggaagcaaatagagcagccttagaggcaaataaggcaaaagccatcatcctaatgactcgtcatatggatgattgttgtgaaattttaattaaaactcgcaagcgcacgaatcgtcgttatatagtatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Retrotran_gag_2 zf-CCHC

Protein Analysis

198

Amino Acids

22.68

Weight (kDa)

10.01

Isoelectric Point (pI)

53.26

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017024)

Species	Orthologous Gene IDs
rosa_laevigata	RLG00000007141
rosa_multiflora	Rmu_sc0000161.1_g000071 Rmu_sc0000986.1_g000031 Rmu_sc0001192.1_g000024 Rmu_sc0001772.1_g000020 Rmu_sc0008622.1_g000004 Rmu_sc0015666.1_g000010 Rmu_sc0019861.1_g000001
rosa_roxburghii	Rroxscaffold_5G00370290
rosa_samantha	Rh2BG437700 Rh2DG447500 Rh4AG284100 Rh4CG305900 Rh4DG287200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	191, 382
AclWI	GGATC	5 cut(s)	77, 90, 146, 154, 167
AcoI	YGGCCR	2 cut(s)	18, 38
AcsI	RAATTY	2 cut(s)	128, 549
AcvI	CACGTG	1 cut(s)	212
AfiI	CCNNNNNNNGG	3 cut(s)	43, 92, 107
AflIII	ACRYGT	1 cut(s)	438
AjiI	CACGTC	1 cut(s)	439
AjnI	CCWGG	4 cut(s)	155, 162, 287, 432
AloI	GAACNNNNNNTCC	2 cut(s)	47, 79
AluBI	AGCT	1 cut(s)	464
AluI	AGCT	1 cut(s)	464
Alw21I	GWGCWC	1 cut(s)	219
AlwI	GGATC	5 cut(s)	77, 90, 146, 154, 167
AoxI	GGCC	3 cut(s)	18, 38, 396
ApeKI	GCWGC	1 cut(s)	482
ApoI	RAATTY	2 cut(s)	128, 549
AspLEI	GCGC	1 cut(s)	573
AspS9I	GGNCC	2 cut(s)	110, 199
AsuHPI	GGTGA	1 cut(s)	90
AvaII	GGWCC	2 cut(s)	110, 199
BamHI	GGATCC	2 cut(s)	82, 159
BauI	CACGAG	1 cut(s)	422
BbrPI	CACGTG	1 cut(s)	212
Bbv12I	GWGCWC	1 cut(s)	219
BbvI	GCAGC	1 cut(s)	494
BccI	CCATC	2 cut(s)	395, 518
BcgI	CGANNNNNNTGC	2 cut(s)	406, 440
BciT130I	CCWGG	4 cut(s)	157, 164, 289, 434
BciVI	GTATCC	1 cut(s)	406
BfaI	CTAG	1 cut(s)	429
BfuI	GTATCC	1 cut(s)	406
BglI	GCCNNNNNGGC	1 cut(s)	491
BisI	GCNGC	1 cut(s)	483
BlsI	GCNGC	1 cut(s)	484
Bme1390I	CCNGG	4 cut(s)	157, 164, 289, 434
Bme18I	GGWCC	2 cut(s)	110, 199
BmgBI	CACGTC	1 cut(s)	439
BmgT120I	GGNCC	2 cut(s)	110, 199
BmiI	GGNNCC	6 cut(s)	6, 84, 161, 168, 200, 201
BmrFI	CCNGG	4 cut(s)	157, 164, 289, 434
BmsI	GCATC	1 cut(s)	397
BpuEI	CTTGAG	1 cut(s)	377
BsaAI	YACGTR	1 cut(s)	212
BsaJI	CCNNGG	1 cut(s)	155
BsaWI	WCCGGW	1 cut(s)	43
BsaXI	ACNNNNNCTCC	2 cut(s)	47, 77
Bsc4I	CCNNNNNNNGG	3 cut(s)	43, 92, 107
Bse118I	RCCGGY	2 cut(s)	16, 36
Bse1I	ACTGG	3 cut(s)	97, 250, 352
BseBI	CCWGG	4 cut(s)	157, 164, 289, 434
BseDI	CCNNGG	1 cut(s)	155
BseGI	GGATG	3 cut(s)	309, 513, 541
BseLI	CCNNNNNNNGG	3 cut(s)	43, 92, 107
BseNI	ACTGG	3 cut(s)	97, 250, 352
BseXI	GCAGC	1 cut(s)	494
BsgI	GTGCAG	1 cut(s)	73
BshFI	GGCC	3 cut(s)	20, 40, 398
BsiHKAI	GWGCWC	1 cut(s)	219
BsiSI	CCGG	3 cut(s)	17, 37, 44
BslFI	GGGAC	1 cut(s)	212
BslI	CCNNNNNNNGG	3 cut(s)	43, 92, 107
BsmFI	GGGAC	1 cut(s)	212
BsnI	GGCC	3 cut(s)	20, 40, 398
Bsp1286I	GDGCHC	1 cut(s)	219
Bsp143I	GATC	4 cut(s)	82, 151, 159, 241
BspACI	CCGC	2 cut(s)	191, 382
BspANI	GGCC	3 cut(s)	20, 40, 398
BspLI	GGNNCC	6 cut(s)	6, 84, 161, 168, 200, 201
BspPI	GGATC	5 cut(s)	77, 90, 146, 154, 167
BsrFI	RCCGGY	2 cut(s)	16, 36
BsrI	ACTGG	3 cut(s)	97, 250, 352
BssAI	RCCGGY	2 cut(s)	16, 36
BssECI	CCNNGG	1 cut(s)	155
BssMI	GATC	4 cut(s)	82, 151, 159, 241
BssSI	CACGAG	1 cut(s)	422
Bst2BI	CACGAG	1 cut(s)	422
Bst2UI	CCWGG	4 cut(s)	157, 164, 289, 434
BstBAI	YACGTR	1 cut(s)	212
BstC8I	GCNNGC	3 cut(s)	386, 456, 569
BstDEI	CTNAG	1 cut(s)	487
BstF5I	GGATG	3 cut(s)	309, 513, 541
BstHHI	GCGC	1 cut(s)	573
BstKTI	GATC	4 cut(s)	85, 154, 162, 244
BstMBI	GATC	4 cut(s)	82, 151, 159, 241
BstMWI	GCNNNNNNNGC	4 cut(s)	470, 479, 491, 500
BstNI	CCWGG	4 cut(s)	157, 164, 289, 434
BstSCI	CCNGG	4 cut(s)	155, 162, 287, 432
BstV1I	GCAGC	1 cut(s)	494
BstX2I	RGATCY	2 cut(s)	82, 159
BstYI	RGATCY	2 cut(s)	82, 159
BsuI	GTATCC	1 cut(s)	406
BsuRI	GGCC	3 cut(s)	20, 40, 398
BtrI	CACGTC	1 cut(s)	439
BtsCI	GGATG	3 cut(s)	309, 513, 541
BtsIMutI	CAGTG	1 cut(s)	90
Cac8I	GCNNGC	3 cut(s)	386, 456, 569
CfoI	GCGC	1 cut(s)	573
Cfr10I	RCCGGY	2 cut(s)	16, 36
Cfr13I	GGNCC	2 cut(s)	110, 199
CviJI	RGCY	9 cut(s)	20, 40, 61, 351, 398, 432, 464, 485, 509
CviKI_1	RGCY	9 cut(s)	20, 40, 61, 351, 398, 432, 464, 485, 509
DdeI	CTNAG	1 cut(s)	487
DpnI	GATC	4 cut(s)	84, 153, 161, 243
DpnII	GATC	4 cut(s)	82, 151, 159, 241
EaeI	YGGCCR	2 cut(s)	18, 38
EciI	GGCGGA	1 cut(s)	371
Eco32I	GATATC	1 cut(s)	359
Eco47I	GGWCC	2 cut(s)	110, 199
Eco72I	CACGTG	1 cut(s)	212
EcoO109I	RGGNCCY	1 cut(s)	199
EcoRII	CCWGG	4 cut(s)	155, 162, 287, 432
EcoRV	GATATC	1 cut(s)	359
FaiI	YATR	5 cut(s)	531, 533, 588, 590, 595
FaqI	GGGAC	1 cut(s)	212
FauNDI	CATATG	1 cut(s)	531
Fnu4HI	GCNGC	1 cut(s)	483
FokI	GGATG	3 cut(s)	316, 500, 548
Fsp4HI	GCNGC	1 cut(s)	483
FspBI	CTAG	1 cut(s)	429
GlaI	GCGC	1 cut(s)	572
GluI	GCNGC	1 cut(s)	483
HaeIII	GGCC	3 cut(s)	20, 40, 398
HapII	CCGG	3 cut(s)	17, 37, 44
HhaI	GCGC	1 cut(s)	573
Hin6I	GCGC	1 cut(s)	571
HinP1I	GCGC	1 cut(s)	571
HincII	GTYRAC	3 cut(s)	225, 235, 255
HindII	GTYRAC	3 cut(s)	225, 235, 255
HindIII	AAGCTT	1 cut(s)	462
HinfI	GANTC	4 cut(s)	405, 418, 523, 577
HpaI	GTTAAC	1 cut(s)	235
HpaII	CCGG	3 cut(s)	17, 37, 44
HphI	GGTGA	1 cut(s)	90
Hpy166II	GTNNAC	4 cut(s)	98, 225, 235, 255
Hpy188I	TCNGA	3 cut(s)	110, 117, 241
Hpy188III	TCNNGA	3 cut(s)	301, 354, 374
Hpy8I	GTNNAC	4 cut(s)	98, 225, 235, 255
Hpy99I	CGWCG	1 cut(s)	585
HpyCH4IV	ACGT	2 cut(s)	211, 438
HpyCH4V	TGCA	1 cut(s)	90
HpyF10VI	GCNNNNNNNGC	4 cut(s)	470, 479, 491, 500
HpyF3I	CTNAG	1 cut(s)	487
HpySE526I	ACGT	2 cut(s)	211, 438
HspAI	GCGC	1 cut(s)	571
KflI	GGGWCCC	1 cut(s)	199
KspAI	GTTAAC	1 cut(s)	235
Kzo9I	GATC	4 cut(s)	82, 151, 159, 241
LmnI	GCTCC	1 cut(s)	337
Lsp1109I	GCAGC	1 cut(s)	494
LweI	GCATC	1 cut(s)	397
MaeI	CTAG	1 cut(s)	429
MaeII	ACGT	2 cut(s)	211, 438
MaeIII	GTNAC	1 cut(s)	308
MalI	GATC	4 cut(s)	84, 153, 161, 243
MboI	GATC	4 cut(s)	82, 151, 159, 241
MboII	GAAGA	1 cut(s)	82
MflI	RGATCY	2 cut(s)	82, 159
MhlI	GDGCHC	1 cut(s)	219
MluCI	AATT	5 cut(s)	128, 320, 444, 549, 555
MlyI	GAGTC	1 cut(s)	517
MnlI	CCTC	5 cut(s)	73, 114, 123, 158, 484
MseI	TTAA	4 cut(s)	234, 443, 554, 558
MslI	CAYNNNNRTG	2 cut(s)	518, 534
MspI	CCGG	3 cut(s)	17, 37, 44
MspR9I	CCNGG	4 cut(s)	157, 164, 289, 434
MvaI	CCWGG	4 cut(s)	157, 164, 289, 434
MwoI	GCNNNNNNNGC	4 cut(s)	470, 479, 491, 500
NdeI	CATATG	1 cut(s)	531
NdeII	GATC	4 cut(s)	82, 151, 159, 241
NlaIV	GGNNCC	6 cut(s)	6, 84, 161, 168, 200, 201
PacI	TTAATTAA	1 cut(s)	558
PfeI	GAWTC	3 cut(s)	405, 418, 577
PfoI	TCCNGGA	1 cut(s)	162
PkrI	GCNGC	1 cut(s)	484
PleI	GAGTC	1 cut(s)	517
PmaCI	CACGTG	1 cut(s)	212
PmlI	CACGTG	1 cut(s)	212
PpsI	GAGTC	1 cut(s)	517
Ppu21I	YACGTR	1 cut(s)	212
PpuMI	RGGWCCY	1 cut(s)	199
Psp5II	RGGWCCY	1 cut(s)	199
Psp6I	CCWGG	4 cut(s)	155, 162, 287, 432
PspCI	CACGTG	1 cut(s)	212
PspGI	CCWGG	4 cut(s)	155, 162, 287, 432
PspN4I	GGNNCC	6 cut(s)	6, 84, 161, 168, 200, 201
PspPI	GGNCC	2 cut(s)	110, 199
PspPPI	RGGWCCY	1 cut(s)	199
PsuI	RGATCY	2 cut(s)	82, 159
RseI	CAYNNNNRTG	2 cut(s)	518, 534
SaqAI	TTAA	4 cut(s)	234, 443, 554, 558
SatI	GCNGC	1 cut(s)	483
Sau3AI	GATC	4 cut(s)	82, 151, 159, 241
Sau96I	GGNCC	2 cut(s)	110, 199
SchI	GAGTC	1 cut(s)	517
ScrFI	CCNGG	4 cut(s)	157, 164, 289, 434
SduI	GDGCHC	1 cut(s)	219
SfaNI	GCATC	1 cut(s)	397
SinI	GGWCC	2 cut(s)	110, 199
SmiMI	CAYNNNNRTG	2 cut(s)	518, 534
SmlI	CTYRAG	1 cut(s)	392
SmoI	CTYRAG	1 cut(s)	392
Sse9I	AATT	5 cut(s)	128, 320, 444, 549, 555
SsiI	CCGC	2 cut(s)	191, 382
SspMI	CTAG	1 cut(s)	429
StyD4I	CCNGG	4 cut(s)	155, 162, 287, 432
TaiI	ACGT	2 cut(s)	214, 441
TaqI	TCGA	2 cut(s)	53, 150
TasI	AATT	5 cut(s)	128, 320, 444, 549, 555
TfiI	GAWTC	3 cut(s)	405, 418, 577
Tru1I	TTAA	4 cut(s)	234, 443, 554, 558
Tru9I	TTAA	4 cut(s)	234, 443, 554, 558
TscAI	CASTG	1 cut(s)	97
TseI	GCWGC	1 cut(s)	482
TspRI	CASTG	1 cut(s)	97
VpaK11BI	GGWCC	2 cut(s)	110, 199
XapI	RAATTY	2 cut(s)	128, 549
XspI	CTAG	1 cut(s)	429

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.