Rmu_sc0000986.1_g000031

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000986.1
Physical Location & Seq
Reverse (-)
170482 .. 170727
246 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000986.1_g000031.1.cds

Sequence Viewer

Length: 246 bp
atgagtaacctgaacagactagacttcgctccattgggaacaactggctctggatatcacaaatgggttcatgatgtccgccaacatctcaaggccgatggaatcctggatacgattctcgagcctagccaggacatgctaactgtcgagcaagctcaagctttggaagaaaatagagcagccttggaggcaaataaggccaaagccatcattctaatgactcgtcatatggatgattctctctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

81

Amino Acids

9.06

Weight (kDa)

5.39

Isoelectric Point (pI)

44.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 79
AjnI CCWGG 2 cut(s) 105, 129
AluBI AGCT 2 cut(s) 155, 161
AluI AGCT 2 cut(s) 155, 161
Ama87I CYCGRG 1 cut(s) 119
AoxI GGCC 2 cut(s) 93, 198
ApeKI GCWGC 1 cut(s) 179
AvaI CYCGRG 1 cut(s) 119
BbvI GCAGC 1 cut(s) 191
BccI CCATC 2 cut(s) 92, 215
BciT130I CCWGG 2 cut(s) 107, 131
BciVI GTATCC 1 cut(s) 103
BfaI CTAG 3 cut(s) 20, 126, 244
BfuI GTATCC 1 cut(s) 103
BglI GCCNNNNNGGC 1 cut(s) 188
BisI GCNGC 1 cut(s) 180
BlsI GCNGC 1 cut(s) 181
Bme1390I CCNGG 2 cut(s) 107, 131
BmeT110I CYCGRG 1 cut(s) 119
BmrFI CCNGG 2 cut(s) 107, 131
BpuEI CTTGAG 2 cut(s) 74, 141
BsaJI CCNNGG 1 cut(s) 183
Bse1I ACTGG 1 cut(s) 49
BseBI CCWGG 2 cut(s) 107, 131
BseDI CCNNGG 1 cut(s) 183
BseGI GGATG 1 cut(s) 238
BseNI ACTGG 1 cut(s) 49
BseXI GCAGC 1 cut(s) 191
BshFI GGCC 2 cut(s) 95, 200
BsiHKCI CYCGRG 1 cut(s) 119
BsnI GGCC 2 cut(s) 95, 200
BsoBI CYCGRG 1 cut(s) 119
BspACI CCGC 1 cut(s) 79
BspANI GGCC 2 cut(s) 95, 200
BspHI TCATGA 1 cut(s) 70
BsrI ACTGG 1 cut(s) 49
BssECI CCNNGG 1 cut(s) 183
BssT1I CCWWGG 1 cut(s) 183
Bst2UI CCWGG 2 cut(s) 107, 131
Bst4CI ACNGT 1 cut(s) 145
BstC8I GCNNGC 1 cut(s) 153
BstF5I GGATG 1 cut(s) 238
BstMWI GCNNNNNNNGC 2 cut(s) 188, 197
BstNI CCWGG 2 cut(s) 107, 131
BstNSI RCATGY 1 cut(s) 139
BstSCI CCNGG 2 cut(s) 105, 129
BstV1I GCAGC 1 cut(s) 191
BsuI GTATCC 1 cut(s) 103
BsuRI GGCC 2 cut(s) 95, 200
BtsCI GGATG 1 cut(s) 238
Cac8I GCNNGC 1 cut(s) 153
CciI TCATGA 1 cut(s) 70
CviAII CATG 2 cut(s) 71, 136
CviJI RGCY 9 cut(s) 48, 95, 124, 129, 155, 161, 182, 200, 206
CviKI_1 RGCY 9 cut(s) 48, 95, 124, 129, 155, 161, 182, 200, 206
EciI GGCGGA 1 cut(s) 68
Eco130I CCWWGG 1 cut(s) 183
Eco32I GATATC 1 cut(s) 56
Eco88I CYCGRG 1 cut(s) 119
EcoRII CCWGG 2 cut(s) 105, 129
EcoRV GATATC 1 cut(s) 56
EcoT14I CCWWGG 1 cut(s) 183
ErhI CCWWGG 1 cut(s) 183
FaeI CATG 2 cut(s) 74, 139
FaiI YATR 4 cut(s) 72, 137, 228, 230
FatI CATG 2 cut(s) 70, 135
FauNDI CATATG 1 cut(s) 228
Fnu4HI GCNGC 1 cut(s) 180
Fsp4HI GCNGC 1 cut(s) 180
FspBI CTAG 3 cut(s) 20, 126, 244
GluI GCNGC 1 cut(s) 180
HaeIII GGCC 2 cut(s) 95, 200
Hin1II CATG 2 cut(s) 74, 139
HindIII AAGCTT 1 cut(s) 159
HinfI GANTC 4 cut(s) 102, 115, 220, 236
Hpy188III TCNNGA 3 cut(s) 51, 71, 119
HpyCH4III ACNGT 1 cut(s) 145
HpyF10VI GCNNNNNNNGC 2 cut(s) 188, 197
Hsp92II CATG 2 cut(s) 74, 139
LmnI GCTCC 1 cut(s) 34
LpnPI CCDG 7 cut(s) 23, 30, 36, 92, 116, 119, 143
Lsp1109I GCAGC 1 cut(s) 191
MaeI CTAG 3 cut(s) 20, 126, 244
MaeIII GTNAC 1 cut(s) 5
MboII GAAGA 1 cut(s) 179
MlyI GAGTC 1 cut(s) 214
MnlI CCTC 1 cut(s) 181
MslI CAYNNNNRTG 2 cut(s) 215, 231
MspR9I CCNGG 2 cut(s) 107, 131
MvaI CCWGG 2 cut(s) 107, 131
MwoI GCNNNNNNNGC 2 cut(s) 188, 197
NdeI CATATG 1 cut(s) 228
NlaIII CATG 2 cut(s) 74, 139
NspI RCATGY 1 cut(s) 139
PaeR7I CTCGAG 1 cut(s) 119
PagI TCATGA 1 cut(s) 70
PfeI GAWTC 3 cut(s) 102, 115, 236
PfoI TCCNGGA 1 cut(s) 105
PkrI GCNGC 1 cut(s) 181
PleI GAGTC 1 cut(s) 214
PpsI GAGTC 1 cut(s) 214
Psp6I CCWGG 2 cut(s) 105, 129
PspGI CCWGG 2 cut(s) 105, 129
RseI CAYNNNNRTG 2 cut(s) 215, 231
SatI GCNGC 1 cut(s) 180
SchI GAGTC 1 cut(s) 214
ScrFI CCNGG 2 cut(s) 107, 131
SetI ASST 3 cut(s) 12, 157, 163
Sfr274I CTCGAG 1 cut(s) 119
SlaI CTCGAG 1 cut(s) 119
SmiMI CAYNNNNRTG 2 cut(s) 215, 231
SmlI CTYRAG 3 cut(s) 89, 119, 156
SmoI CTYRAG 3 cut(s) 89, 119, 156
SsiI CCGC 1 cut(s) 79
SspMI CTAG 3 cut(s) 20, 126, 244
StyD4I CCNGG 2 cut(s) 105, 129
StyI CCWWGG 1 cut(s) 183
TaaI ACNGT 1 cut(s) 145
TaqI TCGA 2 cut(s) 120, 147
TfiI GAWTC 3 cut(s) 102, 115, 236
TseI GCWGC 1 cut(s) 179
TspDTI ATGAA 1 cut(s) 59
XceI RCATGY 1 cut(s) 139
XhoI CTCGAG 1 cut(s) 119
XspI CTAG 3 cut(s) 20, 126, 244
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.