Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008622.1

Orthogroup ID

OG0017024

Physical Location & Seq

Genomic Coordinates Forward (+)

12108 .. 14784

Gene Structure 2677 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008622.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 315 bp

atgctccccaacttttctcttctcatcattaagtactcacgagtccattggagaatgaaggttaatcctggaaggatgagtaacctgaacaaattggattttgctccattgggaacaactggctctggatatcacaagtgggtttgtgatatccgccatcatctcaaggccgatggaatcttggatacgattctcgagcctagccaagacgtgctaactattgagcaagctcaagctttggaagcaaatagagcagccttagaggcaaataaggcgaaagccatcatcctaataacttgtcatatggatgattag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Retrotran_gag_2 zf-CCHC

Protein Analysis

104

Amino Acids

11.71

Weight (kDa)

7.85

Isoelectric Point (pI)

41.25

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017024)

Species	Orthologous Gene IDs
rosa_laevigata	RLG00000007141
rosa_multiflora	Rmu_sc0000161.1_g000071 Rmu_sc0000986.1_g000031 Rmu_sc0001192.1_g000024 Rmu_sc0001772.1_g000020 Rmu_sc0008622.1_g000004 Rmu_sc0015666.1_g000010 Rmu_sc0019861.1_g000001
rosa_roxburghii	Rroxscaffold_5G00370290
rosa_samantha	Rh2BG437700 Rh2DG447500 Rh4AG284100 Rh4CG305900 Rh4DG287200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	154
AfaI	GTAC	1 cut(s)	35
AjiI	CACGTC	1 cut(s)	211
AjnI	CCWGG	1 cut(s)	67
AluBI	AGCT	2 cut(s)	230, 236
AluI	AGCT	2 cut(s)	230, 236
Ama87I	CYCGRG	1 cut(s)	194
AoxI	GGCC	1 cut(s)	168
ApeKI	GCWGC	1 cut(s)	254
AvaI	CYCGRG	1 cut(s)	194
BauI	CACGAG	1 cut(s)	39
BbvI	GCAGC	1 cut(s)	266
BccI	CCATC	3 cut(s)	165, 167, 290
BciT130I	CCWGG	1 cut(s)	69
BciVI	GTATCC	1 cut(s)	178
BfaI	CTAG	1 cut(s)	201
BfuI	GTATCC	1 cut(s)	178
BglI	GCCNNNNNGGC	1 cut(s)	263
BisI	GCNGC	1 cut(s)	255
BlsI	GCNGC	1 cut(s)	256
BmcAI	AGTACT	1 cut(s)	35
Bme1390I	CCNGG	1 cut(s)	69
BmeT110I	CYCGRG	1 cut(s)	194
BmgBI	CACGTC	1 cut(s)	211
BmrFI	CCNGG	1 cut(s)	69
BpuEI	CTTGAG	2 cut(s)	149, 216
Bse1I	ACTGG	1 cut(s)	124
BseBI	CCWGG	1 cut(s)	69
BseGI	GGATG	3 cut(s)	81, 285, 313
BseNI	ACTGG	1 cut(s)	124
BseXI	GCAGC	1 cut(s)	266
BshFI	GGCC	1 cut(s)	170
BsiHKCI	CYCGRG	1 cut(s)	194
BsnI	GGCC	1 cut(s)	170
BsoBI	CYCGRG	1 cut(s)	194
BspACI	CCGC	1 cut(s)	154
BspANI	GGCC	1 cut(s)	170
BsrI	ACTGG	1 cut(s)	124
BssSI	CACGAG	1 cut(s)	39
Bst2BI	CACGAG	1 cut(s)	39
Bst2UI	CCWGG	1 cut(s)	69
Bst6I	CTCTTC	1 cut(s)	24
BstC8I	GCNNGC	1 cut(s)	228
BstDEI	CTNAG	1 cut(s)	259
BstF5I	GGATG	3 cut(s)	81, 285, 313
BstMWI	GCNNNNNNNGC	4 cut(s)	242, 251, 263, 272
BstNI	CCWGG	1 cut(s)	69
BstSCI	CCNGG	1 cut(s)	67
BstV1I	GCAGC	1 cut(s)	266
BsuI	GTATCC	1 cut(s)	178
BsuRI	GGCC	1 cut(s)	170
BtrI	CACGTC	1 cut(s)	211
BtsCI	GGATG	3 cut(s)	81, 285, 313
Cac8I	GCNNGC	1 cut(s)	228
Csp6I	GTAC	1 cut(s)	34
CviJI	RGCY	8 cut(s)	123, 170, 199, 204, 230, 236, 257, 281
CviKI_1	RGCY	8 cut(s)	123, 170, 199, 204, 230, 236, 257, 281
CviQI	GTAC	1 cut(s)	34
DdeI	CTNAG	1 cut(s)	259
Eam1104I	CTCTTC	1 cut(s)	24
EarI	CTCTTC	1 cut(s)	24
EciI	GGCGGA	1 cut(s)	143
Eco32I	GATATC	2 cut(s)	131, 151
Eco88I	CYCGRG	1 cut(s)	194
EcoRII	CCWGG	1 cut(s)	67
EcoRV	GATATC	2 cut(s)	131, 151
FaiI	YATR	2 cut(s)	303, 305
FauNDI	CATATG	1 cut(s)	303
Fnu4HI	GCNGC	1 cut(s)	255
FokI	GGATG	2 cut(s)	88, 272
Fsp4HI	GCNGC	1 cut(s)	255
FspBI	CTAG	1 cut(s)	201
GluI	GCNGC	1 cut(s)	255
HaeIII	GGCC	1 cut(s)	170
HindIII	AAGCTT	1 cut(s)	234
HinfI	GANTC	3 cut(s)	42, 177, 190
Hpy188III	TCNNGA	3 cut(s)	39, 126, 194
HpyAV	CCTTC	2 cut(s)	52, 66
HpyCH4IV	ACGT	1 cut(s)	210
HpyF10VI	GCNNNNNNNGC	4 cut(s)	242, 251, 263, 272
HpyF3I	CTNAG	1 cut(s)	259
HpySE526I	ACGT	1 cut(s)	210
LmnI	GCTCC	2 cut(s)	9, 109
LpnPI	CCDG	5 cut(s)	54, 81, 98, 105, 111
Lsp1109I	GCAGC	1 cut(s)	266
MaeI	CTAG	1 cut(s)	201
MaeII	ACGT	1 cut(s)	210
MaeIII	GTNAC	1 cut(s)	80
MboII	GAAGA	1 cut(s)	11
MluCI	AATT	1 cut(s)	92
MlyI	GAGTC	1 cut(s)	51
MnlI	CCTC	1 cut(s)	256
MseI	TTAA	2 cut(s)	30, 63
MslI	CAYNNNNRTG	1 cut(s)	306
MspR9I	CCNGG	1 cut(s)	69
MvaI	CCWGG	1 cut(s)	69
MwoI	GCNNNNNNNGC	4 cut(s)	242, 251, 263, 272
NdeI	CATATG	1 cut(s)	303
PaeR7I	CTCGAG	1 cut(s)	194
PfeI	GAWTC	2 cut(s)	177, 190
PfoI	TCCNGGA	1 cut(s)	67
PkrI	GCNGC	1 cut(s)	256
PleI	GAGTC	1 cut(s)	50
PpsI	GAGTC	1 cut(s)	50
Psp6I	CCWGG	1 cut(s)	67
PspGI	CCWGG	1 cut(s)	67
RsaI	GTAC	1 cut(s)	35
RsaNI	GTAC	1 cut(s)	34
RseI	CAYNNNNRTG	1 cut(s)	306
SaqAI	TTAA	2 cut(s)	30, 63
SatI	GCNGC	1 cut(s)	255
ScaI	AGTACT	1 cut(s)	35
SchI	GAGTC	1 cut(s)	51
ScrFI	CCNGG	1 cut(s)	69
SetI	ASST	5 cut(s)	63, 87, 213, 232, 238
Sfr274I	CTCGAG	1 cut(s)	194
SlaI	CTCGAG	1 cut(s)	194
SmiMI	CAYNNNNRTG	1 cut(s)	306
SmlI	CTYRAG	3 cut(s)	164, 194, 231
SmoI	CTYRAG	3 cut(s)	164, 194, 231
Sse9I	AATT	1 cut(s)	92
SsiI	CCGC	1 cut(s)	154
SspMI	CTAG	1 cut(s)	201
StyD4I	CCNGG	1 cut(s)	67
TaiI	ACGT	1 cut(s)	213
TaqI	TCGA	1 cut(s)	195
TasI	AATT	1 cut(s)	92
TatI	WGTACW	1 cut(s)	33
TfiI	GAWTC	2 cut(s)	177, 190
Tru1I	TTAA	2 cut(s)	30, 63
Tru9I	TTAA	2 cut(s)	30, 63
TseI	GCWGC	1 cut(s)	254
TspDTI	ATGAA	1 cut(s)	71
XhoI	CTCGAG	1 cut(s)	194
XspI	CTAG	1 cut(s)	201
ZrmI	AGTACT	1 cut(s)	35

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.