Rmu_sc0001192.1_g000024

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001192.1
OG0017024
Physical Location & Seq
Forward (+)
98424 .. 98702
279 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001192.1_g000024.1.cds

Sequence Viewer

Length: 279 bp
atgagtaacctgaacaaattggactttactccattgggaacaattggctctggatatcataggtgggttcgtgatgtccgccagcatctcaaggccgatggaattctggatacggttctcgagcctaaccaggacgtgctaactgttgagcaagctaaagctttggaagcaaatagagcagcattagaggcaaataaggcgaaagccatcatcctaatgactcatcatatggatgattcgctccagtacgagtgtagaaagaagaagatcctggcctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

92

Amino Acids

10.38

Weight (kDa)

7.91

Isoelectric Point (pI)

39.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 79
AclWI GGATC 1 cut(s) 262
AcsI RAATTY 1 cut(s) 102
AfaI GTAC 1 cut(s) 248
AjiI CACGTC 1 cut(s) 136
AjnI CCWGG 2 cut(s) 129, 270
AluBI AGCT 2 cut(s) 155, 161
AluI AGCT 2 cut(s) 155, 161
AlwI GGATC 1 cut(s) 262
Ama87I CYCGRG 1 cut(s) 119
AoxI GGCC 2 cut(s) 93, 273
ApeKI GCWGC 1 cut(s) 179
ApoI RAATTY 1 cut(s) 102
AvaI CYCGRG 1 cut(s) 119
BbvI GCAGC 1 cut(s) 191
BccI CCATC 2 cut(s) 92, 215
BciT130I CCWGG 2 cut(s) 131, 272
BciVI GTATCC 1 cut(s) 103
BfaI CTAG 1 cut(s) 277
BfuI GTATCC 1 cut(s) 103
BisI GCNGC 1 cut(s) 180
BlsI GCNGC 1 cut(s) 181
Bme1390I CCNGG 2 cut(s) 131, 272
BmeT110I CYCGRG 1 cut(s) 119
BmgBI CACGTC 1 cut(s) 136
BmrFI CCNGG 2 cut(s) 131, 272
BmsI GCATC 1 cut(s) 94
BpmI CTGGAG 1 cut(s) 227
BpuEI CTTGAG 1 cut(s) 74
Bse1I ACTGG 1 cut(s) 244
BseBI CCWGG 2 cut(s) 131, 272
BseGI GGATG 2 cut(s) 210, 238
BseNI ACTGG 1 cut(s) 244
BseXI GCAGC 1 cut(s) 191
BshFI GGCC 2 cut(s) 95, 275
BsiHKCI CYCGRG 1 cut(s) 119
BsnI GGCC 2 cut(s) 95, 275
BsoBI CYCGRG 1 cut(s) 119
Bsp143I GATC 1 cut(s) 267
BspACI CCGC 1 cut(s) 79
BspANI GGCC 2 cut(s) 95, 275
BspPI GGATC 1 cut(s) 262
BsrI ACTGG 1 cut(s) 244
BssMI GATC 1 cut(s) 267
Bst2UI CCWGG 2 cut(s) 131, 272
Bst4CI ACNGT 2 cut(s) 115, 145
BstC8I GCNNGC 2 cut(s) 83, 153
BstF5I GGATG 2 cut(s) 210, 238
BstKTI GATC 1 cut(s) 270
BstMBI GATC 1 cut(s) 267
BstMWI GCNNNNNNNGC 4 cut(s) 167, 176, 188, 197
BstNI CCWGG 2 cut(s) 131, 272
BstSCI CCNGG 2 cut(s) 129, 270
BstV1I GCAGC 1 cut(s) 191
BstX2I RGATCY 1 cut(s) 267
BstYI RGATCY 1 cut(s) 267
BsuI GTATCC 1 cut(s) 103
BsuRI GGCC 2 cut(s) 95, 275
BtrI CACGTC 1 cut(s) 136
BtsCI GGATG 2 cut(s) 210, 238
Cac8I GCNNGC 2 cut(s) 83, 153
Csp6I GTAC 1 cut(s) 247
CviJI RGCY 7 cut(s) 48, 95, 124, 155, 161, 206, 275
CviKI_1 RGCY 7 cut(s) 48, 95, 124, 155, 161, 206, 275
CviQI GTAC 1 cut(s) 247
DpnI GATC 1 cut(s) 269
DpnII GATC 1 cut(s) 267
EciI GGCGGA 1 cut(s) 68
Eco32I GATATC 1 cut(s) 56
Eco88I CYCGRG 1 cut(s) 119
EcoRI GAATTC 1 cut(s) 102
EcoRII CCWGG 2 cut(s) 129, 270
EcoRV GATATC 1 cut(s) 56
FaiI YATR 3 cut(s) 60, 228, 230
FauNDI CATATG 1 cut(s) 228
Fnu4HI GCNGC 1 cut(s) 180
FokI GGATG 2 cut(s) 197, 245
Fsp4HI GCNGC 1 cut(s) 180
FspBI CTAG 1 cut(s) 277
GluI GCNGC 1 cut(s) 180
GsuI CTGGAG 1 cut(s) 227
HaeIII GGCC 2 cut(s) 95, 275
HindIII AAGCTT 1 cut(s) 159
HinfI GANTC 2 cut(s) 220, 236
Hpy188III TCNNGA 4 cut(s) 51, 71, 107, 119
HpyCH4III ACNGT 2 cut(s) 115, 145
HpyCH4IV ACGT 1 cut(s) 135
HpyF10VI GCNNNNNNNGC 4 cut(s) 167, 176, 188, 197
HpySE526I ACGT 1 cut(s) 135
Kzo9I GATC 1 cut(s) 267
LmnI GCTCC 1 cut(s) 246
LpnPI CCDG 8 cut(s) 23, 36, 92, 95, 116, 143, 257, 257
Lsp1109I GCAGC 1 cut(s) 191
LweI GCATC 1 cut(s) 94
MaeI CTAG 1 cut(s) 277
MaeII ACGT 1 cut(s) 135
MaeIII GTNAC 1 cut(s) 5
MalI GATC 1 cut(s) 269
MboI GATC 1 cut(s) 267
MboII GAAGA 2 cut(s) 274, 277
MfeI CAATTG 1 cut(s) 42
MflI RGATCY 1 cut(s) 267
MluCI AATT 3 cut(s) 17, 42, 102
MlyI GAGTC 1 cut(s) 214
MnlI CCTC 1 cut(s) 181
MslI CAYNNNNRTG 2 cut(s) 215, 231
MspR9I CCNGG 2 cut(s) 131, 272
MunI CAATTG 1 cut(s) 42
MvaI CCWGG 2 cut(s) 131, 272
MwoI GCNNNNNNNGC 4 cut(s) 167, 176, 188, 197
NdeI CATATG 1 cut(s) 228
NdeII GATC 1 cut(s) 267
PaeR7I CTCGAG 1 cut(s) 119
PfeI GAWTC 1 cut(s) 236
PkrI GCNGC 1 cut(s) 181
PleI GAGTC 1 cut(s) 214
PpsI GAGTC 1 cut(s) 214
Psp6I CCWGG 2 cut(s) 129, 270
PspGI CCWGG 2 cut(s) 129, 270
PsuI RGATCY 1 cut(s) 267
RsaI GTAC 1 cut(s) 248
RsaNI GTAC 1 cut(s) 247
RseI CAYNNNNRTG 2 cut(s) 215, 231
SatI GCNGC 1 cut(s) 180
Sau3AI GATC 1 cut(s) 267
SchI GAGTC 1 cut(s) 214
ScrFI CCNGG 2 cut(s) 131, 272
SetI ASST 5 cut(s) 12, 65, 138, 157, 163
SfaNI GCATC 1 cut(s) 94
Sfr274I CTCGAG 1 cut(s) 119
SlaI CTCGAG 1 cut(s) 119
SmiMI CAYNNNNRTG 2 cut(s) 215, 231
SmlI CTYRAG 2 cut(s) 89, 119
SmoI CTYRAG 2 cut(s) 89, 119
Sse9I AATT 3 cut(s) 17, 42, 102
SsiI CCGC 1 cut(s) 79
SspMI CTAG 1 cut(s) 277
StyD4I CCNGG 2 cut(s) 129, 270
TaaI ACNGT 2 cut(s) 115, 145
TaiI ACGT 1 cut(s) 138
TaqI TCGA 1 cut(s) 120
TasI AATT 3 cut(s) 17, 42, 102
TfiI GAWTC 1 cut(s) 236
TseI GCWGC 1 cut(s) 179
XapI RAATTY 1 cut(s) 102
XhoI CTCGAG 1 cut(s) 119
XspI CTAG 1 cut(s) 277
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.