Rmu_sc0000161.1_g000071

gag-polypeptide of LTR copia-type

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000161.1
Physical Location & Seq
Forward (+)
267626 .. 267850
225 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000161.1_g000071.1.cds

Sequence Viewer

Length: 225 bp
atgagtaacctggacagattggactttgctccattgggaacaattgggtctggatatcacagatgggttcgtgatgtccgccagcatctcaaggccgatggaatccttgatactattctcgagcctagccaagacgtgctaactattgagcaagctcaagctttggaagcaaatagagcagccttagaggcaaataaggcaaaagccatcatcctaatgacttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.19

Weight (kDa)

5.51

Isoelectric Point (pI)

49.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 79
AjiI CACGTC 1 cut(s) 136
AjnI CCWGG 1 cut(s) 9
AluBI AGCT 2 cut(s) 155, 161
AluI AGCT 2 cut(s) 155, 161
Ama87I CYCGRG 1 cut(s) 119
AoxI GGCC 1 cut(s) 93
ApeKI GCWGC 1 cut(s) 179
AvaI CYCGRG 1 cut(s) 119
BbvI GCAGC 1 cut(s) 191
BccI CCATC 3 cut(s) 57, 92, 215
BciT130I CCWGG 1 cut(s) 11
BfaI CTAG 1 cut(s) 126
BglI GCCNNNNNGGC 1 cut(s) 188
BisI GCNGC 1 cut(s) 180
BlsI GCNGC 1 cut(s) 181
Bme1390I CCNGG 1 cut(s) 11
BmeT110I CYCGRG 1 cut(s) 119
BmgBI CACGTC 1 cut(s) 136
BmrFI CCNGG 1 cut(s) 11
BmsI GCATC 1 cut(s) 94
BpuEI CTTGAG 2 cut(s) 74, 141
BseBI CCWGG 1 cut(s) 11
BseGI GGATG 1 cut(s) 210
BseXI GCAGC 1 cut(s) 191
BshFI GGCC 1 cut(s) 95
BsiHKCI CYCGRG 1 cut(s) 119
BsnI GGCC 1 cut(s) 95
BsoBI CYCGRG 1 cut(s) 119
BspACI CCGC 1 cut(s) 79
BspANI GGCC 1 cut(s) 95
Bst2UI CCWGG 1 cut(s) 11
BstC8I GCNNGC 2 cut(s) 83, 153
BstDEI CTNAG 1 cut(s) 184
BstF5I GGATG 1 cut(s) 210
BstMWI GCNNNNNNNGC 4 cut(s) 167, 176, 188, 197
BstNI CCWGG 1 cut(s) 11
BstSCI CCNGG 1 cut(s) 9
BstV1I GCAGC 1 cut(s) 191
BsuRI GGCC 1 cut(s) 95
BtrI CACGTC 1 cut(s) 136
BtsCI GGATG 1 cut(s) 210
Cac8I GCNNGC 2 cut(s) 83, 153
CviJI RGCY 7 cut(s) 95, 124, 129, 155, 161, 182, 206
CviKI_1 RGCY 7 cut(s) 95, 124, 129, 155, 161, 182, 206
DdeI CTNAG 1 cut(s) 184
EciI GGCGGA 1 cut(s) 68
Eco32I GATATC 1 cut(s) 56
Eco88I CYCGRG 1 cut(s) 119
EcoRII CCWGG 1 cut(s) 9
EcoRV GATATC 1 cut(s) 56
Fnu4HI GCNGC 1 cut(s) 180
FokI GGATG 1 cut(s) 197
Fsp4HI GCNGC 1 cut(s) 180
FspBI CTAG 1 cut(s) 126
GluI GCNGC 1 cut(s) 180
HaeIII GGCC 1 cut(s) 95
HindIII AAGCTT 1 cut(s) 159
HinfI GANTC 1 cut(s) 102
Hpy188III TCNNGA 3 cut(s) 51, 71, 119
HpyCH4IV ACGT 1 cut(s) 135
HpyF10VI GCNNNNNNNGC 4 cut(s) 167, 176, 188, 197
HpyF3I CTNAG 1 cut(s) 184
HpySE526I ACGT 1 cut(s) 135
LmnI GCTCC 1 cut(s) 34
LpnPI CCDG 3 cut(s) 23, 36, 95
Lsp1109I GCAGC 1 cut(s) 191
LweI GCATC 1 cut(s) 94
MaeI CTAG 1 cut(s) 126
MaeII ACGT 1 cut(s) 135
MaeIII GTNAC 1 cut(s) 5
MfeI CAATTG 1 cut(s) 42
MluCI AATT 1 cut(s) 42
MnlI CCTC 1 cut(s) 181
MslI CAYNNNNRTG 1 cut(s) 215
MspR9I CCNGG 1 cut(s) 11
MunI CAATTG 1 cut(s) 42
MvaI CCWGG 1 cut(s) 11
MwoI GCNNNNNNNGC 4 cut(s) 167, 176, 188, 197
PaeR7I CTCGAG 1 cut(s) 119
PfeI GAWTC 1 cut(s) 102
PkrI GCNGC 1 cut(s) 181
Psp6I CCWGG 1 cut(s) 9
PspGI CCWGG 1 cut(s) 9
RseI CAYNNNNRTG 1 cut(s) 215
SatI GCNGC 1 cut(s) 180
ScrFI CCNGG 1 cut(s) 11
SetI ASST 4 cut(s) 12, 138, 157, 163
SfaNI GCATC 1 cut(s) 94
Sfr274I CTCGAG 1 cut(s) 119
SlaI CTCGAG 1 cut(s) 119
SmiMI CAYNNNNRTG 1 cut(s) 215
SmlI CTYRAG 3 cut(s) 89, 119, 156
SmoI CTYRAG 3 cut(s) 89, 119, 156
Sse9I AATT 1 cut(s) 42
SsiI CCGC 1 cut(s) 79
SspMI CTAG 1 cut(s) 126
StyD4I CCNGG 1 cut(s) 9
TaiI ACGT 1 cut(s) 138
TaqI TCGA 1 cut(s) 120
TasI AATT 1 cut(s) 42
TfiI GAWTC 1 cut(s) 102
TseI GCWGC 1 cut(s) 179
XhoI CTCGAG 1 cut(s) 119
XspI CTAG 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.