Rmu_sc0015666.1_g000010

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0015666.1
Physical Location & Seq
Reverse (-)
39299 .. 39550
252 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0015666.1_g000010.1.cds

Sequence Viewer

Length: 252 bp
atgagtaacctgaacaaattggactttgctccattgggaacaactggctctagatatcacaggtgggttcgtgatgtccgccagcatctcaaggccgatggaatactagatacaattcttaagcctagccaggacgtgctaactgttgagcaagctcaagctttggaagccaatagagcagccttagaggcaaataaggcgaaagtcatcatcctaatgactcatcatcctaatgactcatcatatggatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.25

Weight (kDa)

8.14

Isoelectric Point (pI)

41.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 79
AflII CTTAAG 1 cut(s) 119
AjiI CACGTC 1 cut(s) 136
AjnI CCWGG 1 cut(s) 129
AluBI AGCT 2 cut(s) 155, 161
AluI AGCT 2 cut(s) 155, 161
AoxI GGCC 1 cut(s) 93
ApeKI GCWGC 1 cut(s) 179
BbvI GCAGC 1 cut(s) 191
BccI CCATC 1 cut(s) 92
BciT130I CCWGG 1 cut(s) 131
BfaI CTAG 3 cut(s) 51, 107, 126
BfrI CTTAAG 1 cut(s) 119
BglI GCCNNNNNGGC 1 cut(s) 188
BisI GCNGC 1 cut(s) 180
BlsI GCNGC 1 cut(s) 181
Bme1390I CCNGG 1 cut(s) 131
BmgBI CACGTC 1 cut(s) 136
BmrFI CCNGG 1 cut(s) 131
BmsI GCATC 1 cut(s) 94
BpuEI CTTGAG 2 cut(s) 74, 141
Bse1I ACTGG 1 cut(s) 49
BseBI CCWGG 1 cut(s) 131
BseGI GGATG 2 cut(s) 210, 226
BseNI ACTGG 1 cut(s) 49
BseXI GCAGC 1 cut(s) 191
BshFI GGCC 1 cut(s) 95
BsnI GGCC 1 cut(s) 95
BspACI CCGC 1 cut(s) 79
BspANI GGCC 1 cut(s) 95
BspTI CTTAAG 1 cut(s) 119
BsrI ACTGG 1 cut(s) 49
Bst2UI CCWGG 1 cut(s) 131
Bst4CI ACNGT 1 cut(s) 145
BstAFI CTTAAG 1 cut(s) 119
BstC8I GCNNGC 2 cut(s) 83, 153
BstDEI CTNAG 1 cut(s) 184
BstF5I GGATG 2 cut(s) 210, 226
BstMWI GCNNNNNNNGC 4 cut(s) 167, 176, 188, 197
BstNI CCWGG 1 cut(s) 131
BstSCI CCNGG 1 cut(s) 129
BstV1I GCAGC 1 cut(s) 191
BsuRI GGCC 1 cut(s) 95
BtrI CACGTC 1 cut(s) 136
BtsCI GGATG 2 cut(s) 210, 226
Cac8I GCNNGC 2 cut(s) 83, 153
CviJI RGCY 8 cut(s) 48, 95, 124, 129, 155, 161, 170, 182
CviKI_1 RGCY 8 cut(s) 48, 95, 124, 129, 155, 161, 170, 182
DdeI CTNAG 1 cut(s) 184
EciI GGCGGA 1 cut(s) 68
Eco32I GATATC 1 cut(s) 56
EcoRII CCWGG 1 cut(s) 129
EcoRV GATATC 1 cut(s) 56
FaiI YATR 2 cut(s) 244, 246
FauNDI CATATG 1 cut(s) 244
Fnu4HI GCNGC 1 cut(s) 180
FokI GGATG 2 cut(s) 197, 213
Fsp4HI GCNGC 1 cut(s) 180
FspBI CTAG 3 cut(s) 51, 107, 126
GluI GCNGC 1 cut(s) 180
HaeIII GGCC 1 cut(s) 95
HindIII AAGCTT 1 cut(s) 159
HinfI GANTC 2 cut(s) 220, 236
Hpy188III TCNNGA 2 cut(s) 51, 71
HpyCH4III ACNGT 1 cut(s) 145
HpyCH4IV ACGT 1 cut(s) 135
HpyF10VI GCNNNNNNNGC 4 cut(s) 167, 176, 188, 197
HpyF3I CTNAG 1 cut(s) 184
HpySE526I ACGT 1 cut(s) 135
LmnI GCTCC 1 cut(s) 34
LpnPI CCDG 6 cut(s) 23, 30, 46, 95, 116, 143
Lsp1109I GCAGC 1 cut(s) 191
LweI GCATC 1 cut(s) 94
MaeI CTAG 3 cut(s) 51, 107, 126
MaeII ACGT 1 cut(s) 135
MaeIII GTNAC 1 cut(s) 5
MluCI AATT 2 cut(s) 17, 114
MlyI GAGTC 2 cut(s) 214, 230
MnlI CCTC 1 cut(s) 181
MseI TTAA 1 cut(s) 120
MslI CAYNNNNRTG 3 cut(s) 215, 231, 247
MspCI CTTAAG 1 cut(s) 119
MspR9I CCNGG 1 cut(s) 131
MvaI CCWGG 1 cut(s) 131
MwoI GCNNNNNNNGC 4 cut(s) 167, 176, 188, 197
NdeI CATATG 1 cut(s) 244
PkrI GCNGC 1 cut(s) 181
PleI GAGTC 2 cut(s) 214, 230
PpsI GAGTC 2 cut(s) 214, 230
Psp6I CCWGG 1 cut(s) 129
PspGI CCWGG 1 cut(s) 129
RseI CAYNNNNRTG 3 cut(s) 215, 231, 247
SaqAI TTAA 1 cut(s) 120
SatI GCNGC 1 cut(s) 180
SchI GAGTC 2 cut(s) 214, 230
ScrFI CCNGG 1 cut(s) 131
SetI ASST 5 cut(s) 12, 65, 138, 157, 163
SfaNI GCATC 1 cut(s) 94
SmiMI CAYNNNNRTG 3 cut(s) 215, 231, 247
SmlI CTYRAG 3 cut(s) 89, 119, 156
SmoI CTYRAG 3 cut(s) 89, 119, 156
Sse9I AATT 2 cut(s) 17, 114
SsiI CCGC 1 cut(s) 79
SspMI CTAG 3 cut(s) 51, 107, 126
StyD4I CCNGG 1 cut(s) 129
TaaI ACNGT 1 cut(s) 145
TaiI ACGT 1 cut(s) 138
TasI AATT 2 cut(s) 17, 114
Tru1I TTAA 1 cut(s) 120
Tru9I TTAA 1 cut(s) 120
TseI GCWGC 1 cut(s) 179
Vha464I CTTAAG 1 cut(s) 119
XbaI TCTAGA 1 cut(s) 50
XspI CTAG 3 cut(s) 51, 107, 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.