Rh6DG404000
MYB Family

Transcriptional activator that binds specific DNA sequence

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Reverse (-)
59201702 .. 59202499
798 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG404000.1

Sequence Viewer

Length: 198 bp
ATGATGAGCCAAGAGCAAGAGCAAGAGATCGACGAAGATCAGTTTCCAATTGGGATGCGTGTGCTTGTGGTAGATGATGATCGCACTGGCCTCCTCGACTTGGAAGCTGTGCTTCTTAACTGCCATTATCATGTTAAAGAGTATCAGCCATCCAGGAACGGCATTGTGGTTGTTAAGAGAAAGCAAGGTCAAGTTTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.54

Weight (kDa)

4.74

Isoelectric Point (pI)

61.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017614)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 100
AjnI CCWGG 1 cut(s) 152
AluBI AGCT 1 cut(s) 107
AluI AGCT 1 cut(s) 107
AoxI GGCC 1 cut(s) 88
BccI CCATC 1 cut(s) 157
BceAI ACGGC 1 cut(s) 175
BciT130I CCWGG 1 cut(s) 154
Bme1390I CCNGG 1 cut(s) 154
BmrFI CCNGG 1 cut(s) 154
BmsI GCATC 1 cut(s) 45
BsaBI GATNNNNATC 1 cut(s) 78
Bsc4I CCNNNNNNNGG 1 cut(s) 100
Bse1I ACTGG 1 cut(s) 91
Bse8I GATNNNNATC 1 cut(s) 78
BseBI CCWGG 1 cut(s) 154
BseGI GGATG 2 cut(s) 60, 149
BseJI GATNNNNATC 1 cut(s) 78
BseLI CCNNNNNNNGG 1 cut(s) 100
BseNI ACTGG 1 cut(s) 91
BseRI GAGGAG 1 cut(s) 83
BshFI GGCC 1 cut(s) 90
BslI CCNNNNNNNGG 1 cut(s) 100
BsnI GGCC 1 cut(s) 90
Bsp143I GATC 3 cut(s) 27, 37, 79
BspANI GGCC 1 cut(s) 90
BsrI ACTGG 1 cut(s) 91
BssMI GATC 3 cut(s) 27, 37, 79
Bst2UI CCWGG 1 cut(s) 154
BstF5I GGATG 2 cut(s) 60, 149
BstKTI GATC 3 cut(s) 30, 40, 82
BstMBI GATC 3 cut(s) 27, 37, 79
BstNI CCWGG 1 cut(s) 154
BstSCI CCNGG 1 cut(s) 152
BsuRI GGCC 1 cut(s) 90
BtsCI GGATG 2 cut(s) 60, 149
BtsIMutI CAGTG 1 cut(s) 84
CviAII CATG 1 cut(s) 131
CviJI RGCY 4 cut(s) 9, 90, 107, 148
CviKI_1 RGCY 4 cut(s) 9, 90, 107, 148
DpnI GATC 3 cut(s) 29, 39, 81
DpnII GATC 3 cut(s) 27, 37, 79
EcoRII CCWGG 1 cut(s) 152
FaeI CATG 1 cut(s) 134
FaiI YATR 1 cut(s) 132
FalI AAGNNNNNCTT 2 cut(s) 96, 128
FatI CATG 1 cut(s) 130
FokI GGATG 2 cut(s) 67, 136
HaeIII GGCC 1 cut(s) 90
Hin1II CATG 1 cut(s) 134
Hpy99I CGWCG 1 cut(s) 35
Hsp92II CATG 1 cut(s) 134
Kzo9I GATC 3 cut(s) 27, 37, 79
LpnPI CCDG 3 cut(s) 72, 139, 166
LweI GCATC 1 cut(s) 45
MalI GATC 3 cut(s) 29, 39, 81
MboI GATC 3 cut(s) 27, 37, 79
MboII GAAGA 1 cut(s) 47
MfeI CAATTG 1 cut(s) 48
MluCI AATT 1 cut(s) 48
MnlI CCTC 2 cut(s) 101, 104
MseI TTAA 3 cut(s) 117, 135, 174
MslI CAYNNNNRTG 1 cut(s) 129
MspR9I CCNGG 1 cut(s) 154
MunI CAATTG 1 cut(s) 48
MvaI CCWGG 1 cut(s) 154
NdeII GATC 3 cut(s) 27, 37, 79
NlaIII CATG 1 cut(s) 134
PfoI TCCNGGA 1 cut(s) 152
Psp6I CCWGG 1 cut(s) 152
PspGI CCWGG 1 cut(s) 152
RseI CAYNNNNRTG 1 cut(s) 129
SaqAI TTAA 3 cut(s) 117, 135, 174
Sau3AI GATC 3 cut(s) 27, 37, 79
ScrFI CCNGG 1 cut(s) 154
SetI ASST 2 cut(s) 109, 190
SfaNI GCATC 1 cut(s) 45
SmiMI CAYNNNNRTG 1 cut(s) 129
Sse9I AATT 1 cut(s) 48
StyD4I CCNGG 1 cut(s) 152
TaqI TCGA 2 cut(s) 30, 96
TasI AATT 1 cut(s) 48
Tru1I TTAA 3 cut(s) 117, 135, 174
Tru9I TTAA 3 cut(s) 117, 135, 174
TscAI CASTG 1 cut(s) 91
TspRI CASTG 1 cut(s) 91
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.