Rh6BG411100
MYB Family

Transcriptional activator that binds specific DNA sequence

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Reverse (-)
63687846 .. 63688640
795 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG411100.1

Sequence Viewer

Length: 195 bp
ATGAGCCAAGAGCAAGAGCAAGAGATCGACGAAGATCAGTTTCCAATTGGGATGCGTGTGCTTGTGGTAGATGATGATCGCACTGGCCTCCTCGACTTGGAAGCTGTGCTTCTTAACTGCCATTATCATGTTAAAGAGTATCAGCCATCCAGGAACGGCATTGTGGTTGTTAAGAGAAAGCAAGGTCAAGTTTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.41

Weight (kDa)

4.74

Isoelectric Point (pI)

62.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017614)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 97
AjnI CCWGG 1 cut(s) 149
AluBI AGCT 1 cut(s) 104
AluI AGCT 1 cut(s) 104
AoxI GGCC 1 cut(s) 85
BccI CCATC 1 cut(s) 154
BceAI ACGGC 1 cut(s) 172
BciT130I CCWGG 1 cut(s) 151
Bme1390I CCNGG 1 cut(s) 151
BmrFI CCNGG 1 cut(s) 151
BmsI GCATC 1 cut(s) 42
BsaBI GATNNNNATC 1 cut(s) 75
Bsc4I CCNNNNNNNGG 1 cut(s) 97
Bse1I ACTGG 1 cut(s) 88
Bse8I GATNNNNATC 1 cut(s) 75
BseBI CCWGG 1 cut(s) 151
BseGI GGATG 2 cut(s) 57, 146
BseJI GATNNNNATC 1 cut(s) 75
BseLI CCNNNNNNNGG 1 cut(s) 97
BseNI ACTGG 1 cut(s) 88
BseRI GAGGAG 1 cut(s) 80
BshFI GGCC 1 cut(s) 87
BslI CCNNNNNNNGG 1 cut(s) 97
BsnI GGCC 1 cut(s) 87
Bsp143I GATC 3 cut(s) 24, 34, 76
BspANI GGCC 1 cut(s) 87
BsrI ACTGG 1 cut(s) 88
BssMI GATC 3 cut(s) 24, 34, 76
Bst2UI CCWGG 1 cut(s) 151
BstF5I GGATG 2 cut(s) 57, 146
BstKTI GATC 3 cut(s) 27, 37, 79
BstMBI GATC 3 cut(s) 24, 34, 76
BstNI CCWGG 1 cut(s) 151
BstSCI CCNGG 1 cut(s) 149
BsuRI GGCC 1 cut(s) 87
BtsCI GGATG 2 cut(s) 57, 146
BtsIMutI CAGTG 1 cut(s) 81
CviAII CATG 1 cut(s) 128
CviJI RGCY 4 cut(s) 6, 87, 104, 145
CviKI_1 RGCY 4 cut(s) 6, 87, 104, 145
DpnI GATC 3 cut(s) 26, 36, 78
DpnII GATC 3 cut(s) 24, 34, 76
EcoRII CCWGG 1 cut(s) 149
FaeI CATG 1 cut(s) 131
FaiI YATR 1 cut(s) 129
FalI AAGNNNNNCTT 2 cut(s) 93, 125
FatI CATG 1 cut(s) 127
FokI GGATG 2 cut(s) 64, 133
HaeIII GGCC 1 cut(s) 87
Hin1II CATG 1 cut(s) 131
Hpy99I CGWCG 1 cut(s) 32
Hsp92II CATG 1 cut(s) 131
Kzo9I GATC 3 cut(s) 24, 34, 76
LpnPI CCDG 3 cut(s) 69, 136, 163
LweI GCATC 1 cut(s) 42
MalI GATC 3 cut(s) 26, 36, 78
MboI GATC 3 cut(s) 24, 34, 76
MboII GAAGA 1 cut(s) 44
MfeI CAATTG 1 cut(s) 45
MluCI AATT 1 cut(s) 45
MnlI CCTC 2 cut(s) 98, 101
MseI TTAA 3 cut(s) 114, 132, 171
MslI CAYNNNNRTG 1 cut(s) 126
MspR9I CCNGG 1 cut(s) 151
MunI CAATTG 1 cut(s) 45
MvaI CCWGG 1 cut(s) 151
NdeII GATC 3 cut(s) 24, 34, 76
NlaIII CATG 1 cut(s) 131
PfoI TCCNGGA 1 cut(s) 149
Psp6I CCWGG 1 cut(s) 149
PspGI CCWGG 1 cut(s) 149
RseI CAYNNNNRTG 1 cut(s) 126
SaqAI TTAA 3 cut(s) 114, 132, 171
Sau3AI GATC 3 cut(s) 24, 34, 76
ScrFI CCNGG 1 cut(s) 151
SetI ASST 2 cut(s) 106, 187
SfaNI GCATC 1 cut(s) 42
SmiMI CAYNNNNRTG 1 cut(s) 126
Sse9I AATT 1 cut(s) 45
StyD4I CCNGG 1 cut(s) 149
TaqI TCGA 2 cut(s) 27, 93
TasI AATT 1 cut(s) 45
Tru1I TTAA 3 cut(s) 114, 132, 171
Tru9I TTAA 3 cut(s) 114, 132, 171
TscAI CASTG 1 cut(s) 88
TspRI CASTG 1 cut(s) 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.