Rh4DG197200
MYB Family

Transcription factor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
OG0018510
Physical Location & Seq
Forward (+)
38476275 .. 38478687
2413 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG197200.1

Sequence Viewer

Length: 156 bp
ATGGAGTTGAGAAAAGGTGCATGGACCAAAGAGGAAGATCATCTTCTCAGGAAATGCATTGAAAAACATGGAGAAGGAAGATGGCACAAGATTCCTCTCCAAGCAGGTGGTCATGGATTGCTGGCCGACTTCCAGGAAGAACCTCAAATGATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04712 map04712
Pfam Domains
Protein Families
Myb_DNA-binding

Protein Analysis

51

Amino Acids

5.97

Weight (kDa)

6.39

Isoelectric Point (pI)

65.43

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-binding PF00249 5 - 37 1e-10 Myb-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018510)

Species Orthologous Gene IDs
malus_domestica MD17G1261200.v1.1
rosa_multiflora Rmu_co8406561.1_g000001 Rmu_sc0018109.1_g000006
rosa_roxburghii Rroxscaffold_1G00004500 Rroxscaffold_5G00359800
rosa_rugosa Rorug04G0450700
rosa_samantha Rh4BG196600 Rh4DG197200 Rh7CG141000 Rh7DG138700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 95
Acc36I ACCTGC 1 cut(s) 95
AcoI YGGCCR 1 cut(s) 123
AgsI TTSAA 1 cut(s) 62
AjnI CCWGG 1 cut(s) 132
AoxI GGCC 1 cut(s) 123
AspS9I GGNCC 1 cut(s) 24
AvaII GGWCC 1 cut(s) 24
BccI CCATC 1 cut(s) 75
BciT130I CCWGG 1 cut(s) 134
BfuAI ACCTGC 1 cut(s) 95
Bme1390I CCNGG 1 cut(s) 134
Bme18I GGWCC 1 cut(s) 24
BmgT120I GGNCC 1 cut(s) 24
BmrFI CCNGG 1 cut(s) 134
BseBI CCWGG 1 cut(s) 134
BseMII CTCAG 1 cut(s) 61
BshFI GGCC 1 cut(s) 125
BsnI GGCC 1 cut(s) 125
Bsp143I GATC 1 cut(s) 37
BspANI GGCC 1 cut(s) 125
BspCNI CTCAG 1 cut(s) 60
BspMI ACCTGC 1 cut(s) 95
BssMI GATC 1 cut(s) 37
Bst2UI CCWGG 1 cut(s) 134
BstC8I GCNNGC 1 cut(s) 123
BstDEI CTNAG 1 cut(s) 47
BstKTI GATC 1 cut(s) 40
BstMBI GATC 1 cut(s) 37
BstNI CCWGG 1 cut(s) 134
BstSCI CCNGG 1 cut(s) 132
BstXI CCANNNNNNTGG 1 cut(s) 107
BsuRI GGCC 1 cut(s) 125
BveI ACCTGC 1 cut(s) 95
Cac8I GCNNGC 1 cut(s) 123
Cfr13I GGNCC 1 cut(s) 24
CviAII CATG 3 cut(s) 21, 68, 113
CviJI RGCY 1 cut(s) 125
CviKI_1 RGCY 1 cut(s) 125
DdeI CTNAG 1 cut(s) 47
DpnI GATC 1 cut(s) 39
DpnII GATC 1 cut(s) 37
EaeI YGGCCR 1 cut(s) 123
Eco47I GGWCC 1 cut(s) 24
EcoRII CCWGG 1 cut(s) 132
EcoT22I ATGCAT 1 cut(s) 59
FaeI CATG 3 cut(s) 24, 71, 116
FaiI YATR 3 cut(s) 22, 69, 114
FalI AAGNNNNNCTT 2 cut(s) 27, 59
FatI CATG 3 cut(s) 20, 67, 112
HaeIII GGCC 1 cut(s) 125
Hin1II CATG 3 cut(s) 24, 71, 116
HinfI GANTC 1 cut(s) 91
Hpy188III TCNNGA 1 cut(s) 49
HpyAV CCTTC 1 cut(s) 68
HpyCH4V TGCA 2 cut(s) 20, 57
HpyF3I CTNAG 1 cut(s) 47
Hsp92II CATG 3 cut(s) 24, 71, 116
Kzo9I GATC 1 cut(s) 37
LpnPI CCDG 5 cut(s) 34, 90, 107, 119, 146
MalI GATC 1 cut(s) 39
MboI GATC 1 cut(s) 37
MboII GAAGA 4 cut(s) 35, 47, 90, 149
MnlI CCTC 3 cut(s) 25, 105, 153
Mph1103I ATGCAT 1 cut(s) 59
MspR9I CCNGG 1 cut(s) 134
MvaI CCWGG 1 cut(s) 134
NdeII GATC 1 cut(s) 37
NlaIII CATG 3 cut(s) 24, 71, 116
NsiI ATGCAT 1 cut(s) 59
PaqCI CACCTGC 1 cut(s) 95
PfeI GAWTC 1 cut(s) 91
PfoI TCCNGGA 1 cut(s) 132
Psp6I CCWGG 1 cut(s) 132
PspGI CCWGG 1 cut(s) 132
PspPI GGNCC 1 cut(s) 24
Sau3AI GATC 1 cut(s) 37
Sau96I GGNCC 1 cut(s) 24
ScrFI CCNGG 1 cut(s) 134
SetI ASST 3 cut(s) 19, 109, 145
SinI GGWCC 1 cut(s) 24
StyD4I CCNGG 1 cut(s) 132
TfiI GAWTC 1 cut(s) 91
VpaK11BI GGWCC 1 cut(s) 24
Zsp2I ATGCAT 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.