Rh4BG196600
MYB Family

Transcription factor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
OG0018510
Physical Location & Seq
Reverse (-)
33884001 .. 33896170
12170 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG196600.1

Sequence Viewer

Length: 162 bp
ATGAAGTTGAGAAAAGGTGCATGGACCAAAGAGGAAGATCATCTTCTCAGGAAGTGCATTGAAAAACATGGAGAAGGAAGATGGCACAAGATTCCTCTCCAAGCAGGAGGTTTCATTACTCGATCAAGGAAGCCAGGGAAAGCAGAGTTTTTTACAACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04712 map04712
Pfam Domains
Protein Families
Myb_DNA-binding

Protein Analysis

53

Amino Acids

6.21

Weight (kDa)

10.22

Isoelectric Point (pI)

59.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-binding PF00249 5 - 44 2.2e-11 Myb-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018510)

Species Orthologous Gene IDs
malus_domestica MD17G1261200.v1.1
rosa_multiflora Rmu_co8406561.1_g000001 Rmu_sc0018109.1_g000006
rosa_roxburghii Rroxscaffold_1G00004500 Rroxscaffold_5G00359800
rosa_rugosa Rorug04G0450700
rosa_samantha Rh4BG196600 Rh4DG197200 Rh7CG141000 Rh7DG138700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 62
AjnI CCWGG 1 cut(s) 133
AspS9I GGNCC 1 cut(s) 24
AvaII GGWCC 1 cut(s) 24
BccI CCATC 1 cut(s) 75
BciT130I CCWGG 1 cut(s) 135
Bme1390I CCNGG 1 cut(s) 135
Bme18I GGWCC 1 cut(s) 24
BmgT120I GGNCC 1 cut(s) 24
BmrFI CCNGG 1 cut(s) 135
BsaJI CCNNGG 1 cut(s) 134
BseBI CCWGG 1 cut(s) 135
BseDI CCNNGG 1 cut(s) 134
BseMII CTCAG 1 cut(s) 61
Bsp143I GATC 2 cut(s) 37, 122
BspCNI CTCAG 1 cut(s) 60
BssECI CCNNGG 1 cut(s) 134
BssMI GATC 2 cut(s) 37, 122
Bst2UI CCWGG 1 cut(s) 135
BstDEI CTNAG 1 cut(s) 47
BstKTI GATC 2 cut(s) 40, 125
BstMBI GATC 2 cut(s) 37, 122
BstNI CCWGG 1 cut(s) 135
BstSCI CCNGG 1 cut(s) 133
Cfr13I GGNCC 1 cut(s) 24
CviAII CATG 2 cut(s) 21, 68
CviJI RGCY 1 cut(s) 133
CviKI_1 RGCY 1 cut(s) 133
DdeI CTNAG 1 cut(s) 47
DpnI GATC 2 cut(s) 39, 124
DpnII GATC 2 cut(s) 37, 122
Eco47I GGWCC 1 cut(s) 24
EcoRII CCWGG 1 cut(s) 133
FaeI CATG 2 cut(s) 24, 71
FaiI YATR 2 cut(s) 22, 69
FalI AAGNNNNNCTT 2 cut(s) 27, 59
FatI CATG 2 cut(s) 20, 67
Hin1II CATG 2 cut(s) 24, 71
HinfI GANTC 1 cut(s) 91
Hpy188III TCNNGA 1 cut(s) 49
HpyAV CCTTC 1 cut(s) 68
HpyCH4V TGCA 2 cut(s) 20, 57
HpyF3I CTNAG 1 cut(s) 47
Hsp92II CATG 2 cut(s) 24, 71
Kzo9I GATC 2 cut(s) 37, 122
LpnPI CCDG 4 cut(s) 34, 90, 120, 147
MalI GATC 2 cut(s) 39, 124
MboI GATC 2 cut(s) 37, 122
MboII GAAGA 3 cut(s) 35, 47, 90
MnlI CCTC 3 cut(s) 25, 101, 105
MseI TTAA 1 cut(s) 160
MspR9I CCNGG 1 cut(s) 135
MvaI CCWGG 1 cut(s) 135
NdeII GATC 2 cut(s) 37, 122
NlaIII CATG 2 cut(s) 24, 71
PfeI GAWTC 1 cut(s) 91
Psp6I CCWGG 1 cut(s) 133
PspGI CCWGG 1 cut(s) 133
PspPI GGNCC 1 cut(s) 24
SaqAI TTAA 1 cut(s) 160
Sau3AI GATC 2 cut(s) 37, 122
Sau96I GGNCC 1 cut(s) 24
ScrFI CCNGG 1 cut(s) 135
SetI ASST 2 cut(s) 19, 112
SinI GGWCC 1 cut(s) 24
StyD4I CCNGG 1 cut(s) 133
TaqI TCGA 1 cut(s) 121
TfiI GAWTC 1 cut(s) 91
Tru1I TTAA 1 cut(s) 160
Tru9I TTAA 1 cut(s) 160
TspDTI ATGAA 2 cut(s) 17, 103
VpaK11BI GGWCC 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.