Rmu_co8406561.1_g000001
MYB Family

Transcription factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8406561.1
Physical Location & Seq
Reverse (-)
2 .. 188
187 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8406561.1_g000001.1.cds

Sequence Viewer

Length: 187 bp
atgacacacagcggtaacggcattaatggcggtggtgctgttctcagcggcgagggaaggcctttggagacaaacggcggaatggagggcaataagggcctaaagaaaggtccctggacggcgacggaggatcaaatattgatggactacgtgaggcaacacggcgaagggaactggaattcagtgc
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

6.51

Weight (kDa)

5.48

Isoelectric Point (pI)

7.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018510)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 12, 30, 48, 78
AclWI GGATC 1 cut(s) 138
AcsI RAATTY 1 cut(s) 178
AjnI CCWGG 1 cut(s) 113
Alw26I GTCTC 1 cut(s) 62
AlwI GGATC 1 cut(s) 138
AoxI GGCC 2 cut(s) 59, 97
ApoI RAATTY 1 cut(s) 178
AseI ATTAAT 1 cut(s) 24
AspS9I GGNCC 2 cut(s) 97, 110
AvaII GGWCC 1 cut(s) 110
BccI CCATC 1 cut(s) 136
BceAI ACGGC 4 cut(s) 34, 91, 135, 178
BciT130I CCWGG 1 cut(s) 115
BcoDI GTCTC 1 cut(s) 62
BisI GCNGC 1 cut(s) 49
BlsI GCNGC 1 cut(s) 50
Bme1390I CCNGG 1 cut(s) 115
Bme18I GGWCC 1 cut(s) 110
BmgT120I GGNCC 2 cut(s) 97, 110
BmiI GGNNCC 1 cut(s) 112
BmrFI CCNGG 1 cut(s) 115
BsaAI YACGTR 1 cut(s) 151
BsaJI CCNNGG 1 cut(s) 113
Bse1I ACTGG 1 cut(s) 179
BseBI CCWGG 1 cut(s) 115
BseDI CCNNGG 1 cut(s) 113
BseMII CTCAG 1 cut(s) 58
BseNI ACTGG 1 cut(s) 179
BshFI GGCC 2 cut(s) 61, 99
BslFI GGGAC 1 cut(s) 96
BsmAI GTCTC 1 cut(s) 62
BsmFI GGGAC 1 cut(s) 96
BsnI GGCC 2 cut(s) 61, 99
Bsp143I GATC 1 cut(s) 130
BspACI CCGC 4 cut(s) 12, 30, 48, 78
BspANI GGCC 2 cut(s) 61, 99
BspCNI CTCAG 1 cut(s) 57
BspLI GGNNCC 1 cut(s) 112
BspPI GGATC 1 cut(s) 138
BsrI ACTGG 1 cut(s) 179
BssECI CCNNGG 1 cut(s) 113
BssMI GATC 1 cut(s) 130
Bst2UI CCWGG 1 cut(s) 115
BstBAI YACGTR 1 cut(s) 151
BstDEI CTNAG 1 cut(s) 44
BstKTI GATC 1 cut(s) 133
BstMAI GTCTC 1 cut(s) 62
BstMBI GATC 1 cut(s) 130
BstMWI GCNNNNNNNGC 3 cut(s) 18, 27, 96
BstNI CCWGG 1 cut(s) 115
BstSCI CCNGG 1 cut(s) 113
BsuRI GGCC 2 cut(s) 61, 99
Cfr13I GGNCC 2 cut(s) 97, 110
CviJI RGCY 2 cut(s) 61, 99
CviKI_1 RGCY 2 cut(s) 61, 99
DdeI CTNAG 1 cut(s) 44
DpnI GATC 1 cut(s) 132
DpnII GATC 1 cut(s) 130
EciI GGCGGA 1 cut(s) 93
Eco147I AGGCCT 1 cut(s) 61
Eco47I GGWCC 1 cut(s) 110
EcoO109I RGGNCCY 2 cut(s) 97, 110
EcoRI GAATTC 1 cut(s) 178
EcoRII CCWGG 1 cut(s) 113
FaqI GGGAC 1 cut(s) 96
Fnu4HI GCNGC 1 cut(s) 49
Fsp4HI GCNGC 1 cut(s) 49
GluI GCNGC 1 cut(s) 49
HaeIII GGCC 2 cut(s) 61, 99
Hpy99I CGWCG 1 cut(s) 127
HpyAV CCTTC 2 cut(s) 51, 161
HpyCH4IV ACGT 1 cut(s) 150
HpyF10VI GCNNNNNNNGC 3 cut(s) 18, 27, 96
HpyF3I CTNAG 1 cut(s) 44
HpySE526I ACGT 1 cut(s) 150
Kzo9I GATC 1 cut(s) 130
LpnPI CCDG 3 cut(s) 100, 127, 160
MaeII ACGT 1 cut(s) 150
MaeIII GTNAC 1 cut(s) 14
MalI GATC 1 cut(s) 132
MboI GATC 1 cut(s) 130
MluCI AATT 1 cut(s) 178
MnlI CCTC 4 cut(s) 46, 79, 121, 147
MseI TTAA 1 cut(s) 24
MspA1I CMGCKG 2 cut(s) 12, 48
MspR9I CCNGG 1 cut(s) 115
MvaI CCWGG 1 cut(s) 115
MwoI GCNNNNNNNGC 3 cut(s) 18, 27, 96
NdeII GATC 1 cut(s) 130
NlaIV GGNNCC 1 cut(s) 112
PceI AGGCCT 1 cut(s) 61
PkrI GCNGC 1 cut(s) 50
Ppu21I YACGTR 1 cut(s) 151
PpuMI RGGWCCY 1 cut(s) 110
PshBI ATTAAT 1 cut(s) 24
Psp5II RGGWCCY 1 cut(s) 110
Psp6I CCWGG 1 cut(s) 113
PspGI CCWGG 1 cut(s) 113
PspN4I GGNNCC 1 cut(s) 112
PspPI GGNCC 2 cut(s) 97, 110
PspPPI RGGWCCY 1 cut(s) 110
SaqAI TTAA 1 cut(s) 24
SatI GCNGC 1 cut(s) 49
Sau3AI GATC 1 cut(s) 130
Sau96I GGNCC 2 cut(s) 97, 110
ScrFI CCNGG 1 cut(s) 115
SetI ASST 2 cut(s) 112, 153
SgeI CNNG 5 cut(s) 64, 126, 127, 163, 173
SinI GGWCC 1 cut(s) 110
Sse9I AATT 1 cut(s) 178
SseBI AGGCCT 1 cut(s) 61
SsiI CCGC 4 cut(s) 12, 30, 48, 78
SspI AATATT 1 cut(s) 138
StuI AGGCCT 1 cut(s) 61
StyD4I CCNGG 1 cut(s) 113
TaiI ACGT 1 cut(s) 153
TasI AATT 1 cut(s) 178
TauI GCSGC 1 cut(s) 51
Tru1I TTAA 1 cut(s) 24
Tru9I TTAA 1 cut(s) 24
TspGWI ACGGA 1 cut(s) 140
VpaK11BI GGWCC 1 cut(s) 110
VspI ATTAAT 1 cut(s) 24
XapI RAATTY 1 cut(s) 178
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.