Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0028385.1

Orthogroup ID

OG0019088

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 250

Gene Structure 249 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0028385.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 249 bp

atgagtaacctgaacaaattggactttgctccattgggaacaactggctctggatatcacaggtgggttcgtgatatccgccagcatctcaaggctgatagaatcctagatatgattctcaagcctagccaggacgtgctaactgttgatcaagctcaagctttgaaaaaaaatagagcagccttagaggcaaataaggcgaaagccatcatcctaatgactcgtcatatggatgattcgctccagtac

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Retrotran_gag_2 zf-CCHC

Protein Analysis

83

Amino Acids

9.46

Weight (kDa)

9.69

Isoelectric Point (pI)

41.4

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019088)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0000156.1_g000003 Rmu_sc0001188.1_g000026 Rmu_sc0002005.1_g000009 Rmu_sc0002320.1_g000012 Rmu_sc0002451.1_g000005 Rmu_sc0005791.1_g000021 Rmu_sc0006420.1_g000042 Rmu_sc0028385.1_g000001
rosa_samantha	Rh2BG189700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	79
AfaI	GTAC	1 cut(s)	248
AgsI	TTSAA	1 cut(s)	166
AjiI	CACGTC	1 cut(s)	136
AjnI	CCWGG	1 cut(s)	129
AluBI	AGCT	2 cut(s)	155, 161
AluI	AGCT	2 cut(s)	155, 161
ApeKI	GCWGC	1 cut(s)	179
BbvI	GCAGC	1 cut(s)	191
BccI	CCATC	1 cut(s)	215
BciT130I	CCWGG	1 cut(s)	131
BclI	TGATCA	1 cut(s)	148
BfaI	CTAG	2 cut(s)	107, 126
BglI	GCCNNNNNGGC	1 cut(s)	188
BisI	GCNGC	1 cut(s)	180
BlsI	GCNGC	1 cut(s)	181
Bme1390I	CCNGG	1 cut(s)	131
BmgBI	CACGTC	1 cut(s)	136
BmrFI	CCNGG	1 cut(s)	131
BmsI	GCATC	1 cut(s)	94
BpmI	CTGGAG	1 cut(s)	227
BpuEI	CTTGAG	3 cut(s)	74, 104, 141
Bse1I	ACTGG	2 cut(s)	49, 244
BseBI	CCWGG	1 cut(s)	131
BseGI	GGATG	2 cut(s)	210, 238
BseNI	ACTGG	2 cut(s)	49, 244
BseXI	GCAGC	1 cut(s)	191
Bsp143I	GATC	1 cut(s)	148
BspACI	CCGC	1 cut(s)	79
BsrI	ACTGG	2 cut(s)	49, 244
BssMI	GATC	1 cut(s)	148
Bst2UI	CCWGG	1 cut(s)	131
Bst4CI	ACNGT	1 cut(s)	145
BstC8I	GCNNGC	1 cut(s)	83
BstDEI	CTNAG	1 cut(s)	184
BstF5I	GGATG	2 cut(s)	210, 238
BstKTI	GATC	1 cut(s)	151
BstMBI	GATC	1 cut(s)	148
BstMWI	GCNNNNNNNGC	2 cut(s)	188, 197
BstNI	CCWGG	1 cut(s)	131
BstSCI	CCNGG	1 cut(s)	129
BstV1I	GCAGC	1 cut(s)	191
BtrI	CACGTC	1 cut(s)	136
BtsCI	GGATG	2 cut(s)	210, 238
Cac8I	GCNNGC	1 cut(s)	83
Csp6I	GTAC	1 cut(s)	247
CviJI	RGCY	8 cut(s)	48, 95, 124, 129, 155, 161, 182, 206
CviKI_1	RGCY	8 cut(s)	48, 95, 124, 129, 155, 161, 182, 206
CviQI	GTAC	1 cut(s)	247
DdeI	CTNAG	1 cut(s)	184
DpnI	GATC	1 cut(s)	150
DpnII	GATC	1 cut(s)	148
EciI	GGCGGA	1 cut(s)	68
Eco32I	GATATC	2 cut(s)	56, 76
EcoRII	CCWGG	1 cut(s)	129
EcoRV	GATATC	2 cut(s)	56, 76
FaiI	YATR	3 cut(s)	113, 228, 230
FauNDI	CATATG	1 cut(s)	228
FbaI	TGATCA	1 cut(s)	148
Fnu4HI	GCNGC	1 cut(s)	180
FokI	GGATG	2 cut(s)	197, 245
Fsp4HI	GCNGC	1 cut(s)	180
FspBI	CTAG	2 cut(s)	107, 126
GluI	GCNGC	1 cut(s)	180
GsuI	CTGGAG	1 cut(s)	227
HindIII	AAGCTT	1 cut(s)	159
HinfI	GANTC	4 cut(s)	102, 115, 220, 236
Hpy188III	TCNNGA	2 cut(s)	51, 71
HpyCH4III	ACNGT	1 cut(s)	145
HpyCH4IV	ACGT	1 cut(s)	135
HpyF10VI	GCNNNNNNNGC	2 cut(s)	188, 197
HpyF3I	CTNAG	1 cut(s)	184
HpySE526I	ACGT	1 cut(s)	135
Ksp22I	TGATCA	1 cut(s)	148
Kzo9I	GATC	1 cut(s)	148
LmnI	GCTCC	2 cut(s)	34, 246
LpnPI	CCDG	7 cut(s)	23, 30, 36, 46, 95, 116, 143
Lsp1109I	GCAGC	1 cut(s)	191
LweI	GCATC	1 cut(s)	94
MaeI	CTAG	2 cut(s)	107, 126
MaeII	ACGT	1 cut(s)	135
MaeIII	GTNAC	1 cut(s)	5
MalI	GATC	1 cut(s)	150
MboI	GATC	1 cut(s)	148
MluCI	AATT	1 cut(s)	17
MlyI	GAGTC	1 cut(s)	214
MnlI	CCTC	1 cut(s)	181
MslI	CAYNNNNRTG	2 cut(s)	215, 231
MspR9I	CCNGG	1 cut(s)	131
MvaI	CCWGG	1 cut(s)	131
MwoI	GCNNNNNNNGC	2 cut(s)	188, 197
NdeI	CATATG	1 cut(s)	228
NdeII	GATC	1 cut(s)	148
PfeI	GAWTC	3 cut(s)	102, 115, 236
PkrI	GCNGC	1 cut(s)	181
PleI	GAGTC	1 cut(s)	214
PpsI	GAGTC	1 cut(s)	214
Psp6I	CCWGG	1 cut(s)	129
PspGI	CCWGG	1 cut(s)	129
RsaI	GTAC	1 cut(s)	248
RsaNI	GTAC	1 cut(s)	247
RseI	CAYNNNNRTG	2 cut(s)	215, 231
SatI	GCNGC	1 cut(s)	180
Sau3AI	GATC	1 cut(s)	148
SchI	GAGTC	1 cut(s)	214
ScrFI	CCNGG	1 cut(s)	131
SetI	ASST	5 cut(s)	12, 65, 138, 157, 163
SfaNI	GCATC	1 cut(s)	94
SmiMI	CAYNNNNRTG	2 cut(s)	215, 231
SmlI	CTYRAG	3 cut(s)	89, 119, 156
SmoI	CTYRAG	3 cut(s)	89, 119, 156
Sse9I	AATT	1 cut(s)	17
SsiI	CCGC	1 cut(s)	79
SspMI	CTAG	2 cut(s)	107, 126
StyD4I	CCNGG	1 cut(s)	129
TaaI	ACNGT	1 cut(s)	145
TaiI	ACGT	1 cut(s)	138
TasI	AATT	1 cut(s)	17
TfiI	GAWTC	3 cut(s)	102, 115, 236
TseI	GCWGC	1 cut(s)	179
XspI	CTAG	2 cut(s)	107, 126

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.