Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002451.1

Orthogroup ID

OG0019088

Physical Location & Seq

Genomic Coordinates Forward (+)

15489 .. 15740

Gene Structure 252 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002451.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 252 bp

atgaataacctgaacaaactggacttcgctccattgggaacaactggctctggatatcacaggtgggttcgtgatgtttgccagcatctcaaggccgatggaatcttggatatgattctcgagcctagccaggatgtgctaactattgagcaagctcaagctttggaagcaaatagagcagccttagaggcaaataaggagaaagtcatcattctaatgactcgccatatggatgattcgctccagtactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000981 GO:0000988 GO:0000989 GO:0001067 GO:0001076 GO:0001134 GO:0001135 GO:0003674 GO:0003676 GO:0003677 GO:0003700 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006355 GO:0006357 GO:0006950 GO:0008150 GO:0009266 GO:0009409 GO:0009628 GO:0009889 GO:0009891 GO:0009893 GO:0009987 GO:0010468 GO:0010556 GO:0010557 GO:0010604 GO:0010628 GO:0019219 GO:0019222 GO:0030154 GO:0031323 GO:0031325 GO:0031326 GO:0031328 GO:0032502 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043565 GO:0044212 GO:0044424 GO:0044464 GO:0045893 GO:0045935 GO:0048518 GO:0048522 GO:0048869 GO:0050789 GO:0050794 GO:0050896 GO:0051171 GO:0051173 GO:0051252 GO:0051254 GO:0060255 GO:0065007 GO:0080090 GO:0097159 GO:0140110 GO:1901363 GO:1902680 GO:1903506 GO:1903508 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Myb_DNA-binding

Protein Analysis

83

Amino Acids

9.38

Weight (kDa)

5.14

Isoelectric Point (pI)

46.44

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019088)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0000156.1_g000003 Rmu_sc0001188.1_g000026 Rmu_sc0002005.1_g000009 Rmu_sc0002320.1_g000012 Rmu_sc0002451.1_g000005 Rmu_sc0005791.1_g000021 Rmu_sc0006420.1_g000042 Rmu_sc0028385.1_g000001
rosa_samantha	Rh2BG189700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfaI	GTAC	1 cut(s)	248
AjnI	CCWGG	1 cut(s)	129
AluBI	AGCT	2 cut(s)	155, 161
AluI	AGCT	2 cut(s)	155, 161
Ama87I	CYCGRG	1 cut(s)	119
AoxI	GGCC	1 cut(s)	93
ApeKI	GCWGC	1 cut(s)	179
AvaI	CYCGRG	1 cut(s)	119
BbvI	GCAGC	1 cut(s)	191
BccI	CCATC	1 cut(s)	92
BciT130I	CCWGG	1 cut(s)	131
BfaI	CTAG	2 cut(s)	126, 250
BglI	GCCNNNNNGGC	1 cut(s)	188
BisI	GCNGC	1 cut(s)	180
BlsI	GCNGC	1 cut(s)	181
BmcAI	AGTACT	1 cut(s)	248
Bme1390I	CCNGG	1 cut(s)	131
BmeT110I	CYCGRG	1 cut(s)	119
BmrFI	CCNGG	1 cut(s)	131
BmsI	GCATC	1 cut(s)	94
BpmI	CTGGAG	1 cut(s)	227
BpuEI	CTTGAG	2 cut(s)	74, 141
Bse1I	ACTGG	3 cut(s)	24, 49, 244
BseBI	CCWGG	1 cut(s)	131
BseGI	GGATG	2 cut(s)	139, 238
BseNI	ACTGG	3 cut(s)	24, 49, 244
BseXI	GCAGC	1 cut(s)	191
BshFI	GGCC	1 cut(s)	95
BsiHKCI	CYCGRG	1 cut(s)	119
BsnI	GGCC	1 cut(s)	95
BsoBI	CYCGRG	1 cut(s)	119
BspANI	GGCC	1 cut(s)	95
BsrI	ACTGG	3 cut(s)	24, 49, 244
Bst2UI	CCWGG	1 cut(s)	131
BstC8I	GCNNGC	2 cut(s)	83, 153
BstDEI	CTNAG	1 cut(s)	184
BstF5I	GGATG	2 cut(s)	139, 238
BstMWI	GCNNNNNNNGC	3 cut(s)	167, 176, 188
BstNI	CCWGG	1 cut(s)	131
BstSCI	CCNGG	1 cut(s)	129
BstV1I	GCAGC	1 cut(s)	191
BsuRI	GGCC	1 cut(s)	95
BtsCI	GGATG	2 cut(s)	139, 238
Cac8I	GCNNGC	2 cut(s)	83, 153
Csp6I	GTAC	1 cut(s)	247
CviJI	RGCY	7 cut(s)	48, 95, 124, 129, 155, 161, 182
CviKI_1	RGCY	7 cut(s)	48, 95, 124, 129, 155, 161, 182
CviQI	GTAC	1 cut(s)	247
DdeI	CTNAG	1 cut(s)	184
Eco32I	GATATC	1 cut(s)	56
Eco88I	CYCGRG	1 cut(s)	119
EcoRII	CCWGG	1 cut(s)	129
EcoRV	GATATC	1 cut(s)	56
FaiI	YATR	3 cut(s)	113, 228, 230
FauNDI	CATATG	1 cut(s)	228
Fnu4HI	GCNGC	1 cut(s)	180
FokI	GGATG	2 cut(s)	146, 245
Fsp4HI	GCNGC	1 cut(s)	180
FspBI	CTAG	2 cut(s)	126, 250
GluI	GCNGC	1 cut(s)	180
GsuI	CTGGAG	1 cut(s)	227
HaeIII	GGCC	1 cut(s)	95
HindIII	AAGCTT	1 cut(s)	159
HinfI	GANTC	4 cut(s)	102, 115, 220, 236
Hpy188III	TCNNGA	3 cut(s)	51, 71, 119
HpyF10VI	GCNNNNNNNGC	3 cut(s)	167, 176, 188
HpyF3I	CTNAG	1 cut(s)	184
LmnI	GCTCC	2 cut(s)	34, 246
LpnPI	CCDG	8 cut(s)	5, 23, 30, 36, 46, 95, 116, 143
Lsp1109I	GCAGC	1 cut(s)	191
LweI	GCATC	1 cut(s)	94
MaeI	CTAG	2 cut(s)	126, 250
MlyI	GAGTC	1 cut(s)	214
MnlI	CCTC	1 cut(s)	181
MslI	CAYNNNNRTG	2 cut(s)	215, 231
MspR9I	CCNGG	1 cut(s)	131
MvaI	CCWGG	1 cut(s)	131
MwoI	GCNNNNNNNGC	3 cut(s)	167, 176, 188
NdeI	CATATG	1 cut(s)	228
PaeR7I	CTCGAG	1 cut(s)	119
PfeI	GAWTC	3 cut(s)	102, 115, 236
PkrI	GCNGC	1 cut(s)	181
PleI	GAGTC	1 cut(s)	214
PpsI	GAGTC	1 cut(s)	214
Psp6I	CCWGG	1 cut(s)	129
PspGI	CCWGG	1 cut(s)	129
RsaI	GTAC	1 cut(s)	248
RsaNI	GTAC	1 cut(s)	247
RseI	CAYNNNNRTG	2 cut(s)	215, 231
SatI	GCNGC	1 cut(s)	180
ScaI	AGTACT	1 cut(s)	248
SchI	GAGTC	1 cut(s)	214
ScrFI	CCNGG	1 cut(s)	131
SetI	ASST	4 cut(s)	12, 65, 157, 163
SfaNI	GCATC	1 cut(s)	94
Sfr274I	CTCGAG	1 cut(s)	119
SlaI	CTCGAG	1 cut(s)	119
SmiMI	CAYNNNNRTG	2 cut(s)	215, 231
SmlI	CTYRAG	3 cut(s)	89, 119, 156
SmoI	CTYRAG	3 cut(s)	89, 119, 156
SspMI	CTAG	2 cut(s)	126, 250
StyD4I	CCNGG	1 cut(s)	129
TaqI	TCGA	1 cut(s)	120
TatI	WGTACW	1 cut(s)	246
TfiI	GAWTC	3 cut(s)	102, 115, 236
TseI	GCWGC	1 cut(s)	179
TspDTI	ATGAA	1 cut(s)	17
XhoI	CTCGAG	1 cut(s)	119
XspI	CTAG	2 cut(s)	126, 250
ZrmI	AGTACT	1 cut(s)	248

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.