Rmu_sc0010739.1_g000008

gag-polypeptide of LTR copia-type

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010739.1
Physical Location & Seq
Forward (+)
38058 .. 38960
903 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010739.1_g000008.1.cds

Sequence Viewer

Length: 747 bp
atgaatactagtcgattggataattgtctcctctccaacttctgcaatctcatcaccatgcagttagatgatactaactatttgacttggagatttgtgctagagtctgtgttggtagggtgtgatcttatggggtatattgatggatctattccttatcctccacaatataaaatcacaaaagagactggtattacccctaaggttacagaagagtataaagaatggaggaagcatgattctgctgtaatgactctactcgctactcttagtatgcctaatgctcctccaaattgtcaagtcctgatcccattcactaccaatgttggtgttccgcagtcagtgcctaattctggatatatgctgcataataatgttggaaatgaaaattgcttttcatcatctgctccctcttatggttattcacctcaaaatggttctagcacttcatatgttcaacagttcaatcttaatcacagtggagctcaacaacatggaaacttctctcaacaaaatgtgcaacctggtacattcaacaatagttctcagcaaaataatggcttttctcgtaaggagaaattttcttcacaggccatgccttgctctgcatcattgtctgctctcagaaatgcagcctctgtgtcttctgcatacaaaatttccacacctgcccaggctcaagatggcaataactcttatgtcactactgaacttcaaggacatgagaatttgaaaacttggacttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

248

Amino Acids

27.28

Weight (kDa)

6.18

Isoelectric Point (pI)

35.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 676
Acc36I ACCTGC 1 cut(s) 676
AciI CCGC 1 cut(s) 335
AclWI GGATC 2 cut(s) 154, 301
AcsI RAATTY 3 cut(s) 578, 657, 727
AfaI GTAC 1 cut(s) 529
AfiI CCNNNNNNNGG 3 cut(s) 353, 416, 434
AgsI TTSAA 5 cut(s) 458, 466, 535, 716, 733
AhlI ACTAGT 1 cut(s) 8
AjnI CCWGG 2 cut(s) 523, 672
AluBI AGCT 1 cut(s) 485
AluI AGCT 1 cut(s) 485
Alw21I GWGCWC 1 cut(s) 487
Alw26I GTCTC 2 cut(s) 32, 179
AlwI GGATC 2 cut(s) 154, 301
AlwNI CAGNNNCTG 1 cut(s) 638
AoxI GGCC 1 cut(s) 591
ApeKI GCWGC 2 cut(s) 364, 632
ApoI RAATTY 3 cut(s) 578, 657, 727
AsuHPI GGTGA 2 cut(s) 46, 417
AxyI CCTNAGG 1 cut(s) 201
BanII GRGCYC 1 cut(s) 487
BbsI GAAGAC 1 cut(s) 636
Bbv12I GWGCWC 1 cut(s) 487
BbvI GCAGC 2 cut(s) 351, 644
BccI CCATC 2 cut(s) 137, 677
BciT130I CCWGG 2 cut(s) 525, 674
BcoDI GTCTC 2 cut(s) 32, 179
BcuI ACTAGT 1 cut(s) 8
BfaI CTAG 3 cut(s) 9, 101, 441
BfuAI ACCTGC 1 cut(s) 676
BisI GCNGC 2 cut(s) 365, 633
BlsI GCNGC 2 cut(s) 366, 634
Bme1390I CCNGG 2 cut(s) 525, 674
BmrFI CCNGG 2 cut(s) 525, 674
BmsI GCATC 1 cut(s) 617
BpiI GAAGAC 1 cut(s) 636
BpuEI CTTGAG 1 cut(s) 663
BsaJI CCNNGG 1 cut(s) 672
Bsc4I CCNNNNNNNGG 3 cut(s) 353, 416, 434
Bse1I ACTGG 1 cut(s) 193
Bse21I CCTNAGG 1 cut(s) 201
BseBI CCWGG 2 cut(s) 525, 674
BseDI CCNNGG 1 cut(s) 672
BseLI CCNNNNNNNGG 3 cut(s) 353, 416, 434
BseMII CTCAG 2 cut(s) 560, 637
BseNI ACTGG 1 cut(s) 193
BseRI GAGGAG 2 cut(s) 20, 276
BseXI GCAGC 2 cut(s) 351, 644
BshFI GGCC 1 cut(s) 593
BsiHKAI GWGCWC 1 cut(s) 487
BslI CCNNNNNNNGG 3 cut(s) 353, 416, 434
BsmAI GTCTC 2 cut(s) 32, 179
BsnI GGCC 1 cut(s) 593
Bsp1286I GDGCHC 1 cut(s) 487
Bsp143I GATC 3 cut(s) 124, 146, 306
BspACI CCGC 1 cut(s) 335
BspANI GGCC 1 cut(s) 593
BspCNI CTCAG 2 cut(s) 559, 636
BspMI ACCTGC 1 cut(s) 676
BspPI GGATC 2 cut(s) 154, 301
BsrI ACTGG 1 cut(s) 193
BssECI CCNNGG 1 cut(s) 672
BssMI GATC 3 cut(s) 124, 146, 306
Bst2UI CCWGG 2 cut(s) 525, 674
Bst4CI ACNGT 2 cut(s) 462, 479
Bst6I CTCTTC 1 cut(s) 207
BstAPI GCANNNNNTGC 1 cut(s) 343
BstDEI CTNAG 5 cut(s) 201, 269, 546, 623, 744
BstKTI GATC 3 cut(s) 127, 149, 309
BstMAI GTCTC 2 cut(s) 32, 179
BstMBI GATC 3 cut(s) 124, 146, 306
BstMWI GCNNNNNNNGC 1 cut(s) 343
BstNI CCWGG 2 cut(s) 525, 674
BstSCI CCNGG 2 cut(s) 523, 672
BstV1I GCAGC 2 cut(s) 351, 644
BstV2I GAAGAC 1 cut(s) 636
BstX2I RGATCY 1 cut(s) 146
BstYI RGATCY 1 cut(s) 146
Bsu36I CCTNAGG 1 cut(s) 201
BsuRI GGCC 1 cut(s) 593
BtsIMutI CAGTG 2 cut(s) 348, 484
BveI ACCTGC 1 cut(s) 676
CaiI CAGNNNCTG 1 cut(s) 638
CsiI ACCWGGT 1 cut(s) 523
Csp6I GTAC 1 cut(s) 528
CviAII CATG 5 cut(s) 58, 236, 494, 595, 722
CviJI RGCY 5 cut(s) 485, 561, 593, 635, 677
CviKI_1 RGCY 5 cut(s) 485, 561, 593, 635, 677
CviQI GTAC 1 cut(s) 528
DdeI CTNAG 5 cut(s) 201, 269, 546, 623, 744
DpnI GATC 3 cut(s) 126, 148, 308
DpnII GATC 3 cut(s) 124, 146, 306
Eam1104I CTCTTC 1 cut(s) 207
EarI CTCTTC 1 cut(s) 207
Ecl136II GAGCTC 1 cut(s) 485
Eco24I GRGCYC 1 cut(s) 487
Eco53kI GAGCTC 1 cut(s) 485
Eco81I CCTNAGG 1 cut(s) 201
EcoICRI GAGCTC 1 cut(s) 485
EcoRII CCWGG 2 cut(s) 523, 672
EcoT38I GRGCYC 1 cut(s) 487
FaeI CATG 5 cut(s) 61, 239, 497, 598, 725
FatI CATG 5 cut(s) 57, 235, 493, 594, 721
FauNDI CATATG 1 cut(s) 451
Fnu4HI GCNGC 2 cut(s) 365, 633
FriOI GRGCYC 1 cut(s) 487
Fsp4HI GCNGC 2 cut(s) 365, 633
FspBI CTAG 3 cut(s) 9, 101, 441
GluI GCNGC 2 cut(s) 365, 633
HaeIII GGCC 1 cut(s) 593
Hin1II CATG 5 cut(s) 61, 239, 497, 598, 725
HinfI GANTC 3 cut(s) 104, 239, 253
HphI GGTGA 2 cut(s) 46, 417
Hpy188I TCNGA 1 cut(s) 626
Hpy188III TCNNGA 3 cut(s) 304, 354, 680
HpyCH4III ACNGT 2 cut(s) 462, 479
HpyCH4V TGCA 7 cut(s) 45, 61, 367, 520, 608, 632, 650
HpyF10VI GCNNNNNNNGC 1 cut(s) 343
HpyF3I CTNAG 5 cut(s) 201, 269, 546, 623, 744
Hsp92II CATG 5 cut(s) 61, 239, 497, 598, 725
Kzo9I GATC 3 cut(s) 124, 146, 306
LmnI GCTCC 3 cut(s) 289, 412, 482
LpnPI CCDG 9 cut(s) 174, 317, 339, 510, 537, 575, 659, 681, 686
Lsp1109I GCAGC 2 cut(s) 351, 644
LweI GCATC 1 cut(s) 617
MabI ACCWGGT 1 cut(s) 523
MaeI CTAG 3 cut(s) 9, 101, 441
MaeIII GTNAC 2 cut(s) 205, 700
MalI GATC 3 cut(s) 126, 148, 308
MboI GATC 3 cut(s) 124, 146, 306
MboII GAAGA 3 cut(s) 224, 576, 636
MflI RGATCY 1 cut(s) 146
MhlI GDGCHC 1 cut(s) 487
MluCI AATT 7 cut(s) 22, 292, 349, 388, 578, 657, 727
MlyI GAGTC 2 cut(s) 113, 247
MmeI TCCRAC 2 cut(s) 60, 358
MnlI CCTC 7 cut(s) 41, 171, 222, 297, 421, 438, 646
MseI TTAA 1 cut(s) 471
MslI CAYNNNNRTG 2 cut(s) 56, 372
MspR9I CCNGG 2 cut(s) 525, 674
MvaI CCWGG 2 cut(s) 525, 674
MwoI GCNNNNNNNGC 1 cut(s) 343
NdeI CATATG 1 cut(s) 451
NdeII GATC 3 cut(s) 124, 146, 306
NlaIII CATG 5 cut(s) 61, 239, 497, 598, 725
NmuCI GTSAC 1 cut(s) 700
PaqCI CACCTGC 1 cut(s) 676
PfeI GAWTC 1 cut(s) 239
PkrI GCNGC 2 cut(s) 366, 634
PleI GAGTC 2 cut(s) 112, 247
PpsI GAGTC 2 cut(s) 112, 247
Psp124BI GAGCTC 1 cut(s) 487
Psp6I CCWGG 2 cut(s) 523, 672
PspGI CCWGG 2 cut(s) 523, 672
PstNI CAGNNNCTG 1 cut(s) 638
PsuI RGATCY 1 cut(s) 146
RsaI GTAC 1 cut(s) 529
RsaNI GTAC 1 cut(s) 528
RseI CAYNNNNRTG 2 cut(s) 56, 372
SacI GAGCTC 1 cut(s) 487
SaqAI TTAA 1 cut(s) 471
SatI GCNGC 2 cut(s) 365, 633
Sau3AI GATC 3 cut(s) 124, 146, 306
SchI GAGTC 2 cut(s) 113, 247
ScrFI CCNGG 2 cut(s) 525, 674
SduI GDGCHC 1 cut(s) 487
SetI ASST 5 cut(s) 207, 430, 487, 526, 670
SexAI ACCWGGT 1 cut(s) 523
SfaNI GCATC 1 cut(s) 617
SmiMI CAYNNNNRTG 2 cut(s) 56, 372
SmlI CTYRAG 1 cut(s) 678
SmoI CTYRAG 1 cut(s) 678
SpeI ACTAGT 1 cut(s) 8
Sse9I AATT 7 cut(s) 22, 292, 349, 388, 578, 657, 727
SsiI CCGC 1 cut(s) 335
SspMI CTAG 3 cut(s) 9, 101, 441
SstI GAGCTC 1 cut(s) 487
StyD4I CCNGG 2 cut(s) 523, 672
TaaI ACNGT 2 cut(s) 462, 479
TaqI TCGA 1 cut(s) 13
TasI AATT 7 cut(s) 22, 292, 349, 388, 578, 657, 727
TfiI GAWTC 1 cut(s) 239
Tru1I TTAA 1 cut(s) 471
Tru9I TTAA 1 cut(s) 471
TscAI CASTG 2 cut(s) 348, 484
TseFI GTSAC 1 cut(s) 700
TseI GCWGC 2 cut(s) 364, 632
Tsp45I GTSAC 1 cut(s) 700
TspDTI ATGAA 4 cut(s) 17, 387, 399, 438
TspRI CASTG 2 cut(s) 348, 484
XapI RAATTY 3 cut(s) 578, 657, 727
XcmI CCANNNNNNNNNTGG 1 cut(s) 680
XspI CTAG 3 cut(s) 9, 101, 441
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.