Rmu_sc0000645.1_g000043
MYB Family

SANT SWI3, ADA2, N-CoR and TFIIIB'' DNA-binding domains

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000645.1
OG0016333
Physical Location & Seq
Forward (+)
172586 .. 173116
531 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000645.1_g000043.1.cds

Sequence Viewer

Length: 531 bp
atgaactatctccgaccaggtataaagagaggtaacataactcctgatgaggaagaccttattgtgaggcttcattcacttctgggaaatcgatggtctctaattgctggaagactccccggtcgaaccgataatgagatcaagaactactggaataccaaccgcagcaaaaggctcaacaacgctggtagtactgaaagaggtgtatctagtgttgaaggacaactcaagaaggatgaccgaggctgtgtagcaaaggttaaggttcatcaaccaaaggccattcgagtttctgcaaactcaatcataagaaacaataacatcttagctgaattgggtcatcatgatgcagaggtttctaatgatcttcatgatcataaacattttggagaggccttggtttgcgaaaatgtgatggattttgatgtttttattcaagggtacgaggaatatcagcagcagcttctcaaggcagatcaagatctcgatggtgttcatttggattcttttgttgactccttgttgatttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-binding

Protein Analysis

176

Amino Acids

19.92

Weight (kDa)

6.05

Isoelectric Point (pI)

33.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016333)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g11430
malus_domestica MD14G1134900.v1.1
prunus_persica Prupe.5G126600_v2.0.a1
rosa_chinensis RchiOBHm_Chr7g0186441
rosa_laevigata RLG00000004845
rosa_multiflora Rmu_sc0000645.1_g000043
rosa_roxburghii Rroxscaffold_2G00076400 Rroxscaffold_3G00268140
rosa_rugosa Rorug06G0474100
rosa_samantha Rh7AG067200 Rh7BG082900 Rh7CG080700 Rh7DG081300
rosa_wichuraiana Rw7G006780 Rw7G007010

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 120
AciI CCGC 1 cut(s) 163
AfaI GTAC 2 cut(s) 193, 443
AgsI TTSAA 2 cut(s) 218, 437
AjnI CCWGG 1 cut(s) 16
AluBI AGCT 2 cut(s) 329, 463
AluI AGCT 2 cut(s) 329, 463
Alw26I GTCTC 1 cut(s) 102
AoxI GGCC 2 cut(s) 279, 393
ApeKI GCWGC 3 cut(s) 165, 457, 460
AsuC2I CCSGG 1 cut(s) 120
BbsI GAAGAC 2 cut(s) 60, 118
BbvI GCAGC 3 cut(s) 177, 469, 472
BccI CCATC 3 cut(s) 87, 409, 482
BciT130I CCWGG 1 cut(s) 18
BclI TGATCA 1 cut(s) 373
BcnI CCSGG 1 cut(s) 120
BcoDI GTCTC 1 cut(s) 102
BfaI CTAG 1 cut(s) 210
BglII AGATCT 1 cut(s) 481
BisI GCNGC 3 cut(s) 166, 458, 461
BlsI GCNGC 3 cut(s) 167, 459, 462
BmcAI AGTACT 1 cut(s) 193
Bme1390I CCNGG 2 cut(s) 18, 120
BmrFI CCNGG 2 cut(s) 18, 120
BmsI GCATC 1 cut(s) 337
BpiI GAAGAC 2 cut(s) 60, 118
BpuEI CTTGAG 2 cut(s) 212, 452
BpuMI CCSGG 1 cut(s) 120
Bsa29I ATCGAT 1 cut(s) 91
BsaBI GATNNNNATC 1 cut(s) 480
BsaI GGTCTC 1 cut(s) 102
BsaJI CCNNGG 3 cut(s) 118, 241, 396
Bse1I ACTGG 1 cut(s) 155
Bse8I GATNNNNATC 1 cut(s) 480
BseBI CCWGG 1 cut(s) 18
BseCI ATCGAT 1 cut(s) 91
BseDI CCNNGG 3 cut(s) 118, 241, 396
BseGI GGATG 1 cut(s) 241
BseJI GATNNNNATC 1 cut(s) 480
BseNI ACTGG 1 cut(s) 155
BseXI GCAGC 3 cut(s) 177, 469, 472
Bsh1285I CGRYCG 1 cut(s) 124
BshFI GGCC 2 cut(s) 281, 395
BshVI ATCGAT 1 cut(s) 91
BsiEI CGRYCG 1 cut(s) 124
BsiSI CCGG 1 cut(s) 120
BsmAI GTCTC 1 cut(s) 102
BsnI GGCC 2 cut(s) 281, 395
Bso31I GGTCTC 1 cut(s) 102
Bsp143I GATC 5 cut(s) 138, 364, 373, 475, 481
BspACI CCGC 1 cut(s) 163
BspANI GGCC 2 cut(s) 281, 395
BspDI ATCGAT 1 cut(s) 91
BspHI TCATGA 2 cut(s) 343, 370
BspTNI GGTCTC 1 cut(s) 102
BsrI ACTGG 1 cut(s) 155
BssECI CCNNGG 3 cut(s) 118, 241, 396
BssMI GATC 5 cut(s) 138, 364, 373, 475, 481
BssT1I CCWWGG 1 cut(s) 396
Bst2UI CCWGG 1 cut(s) 18
BstDEI CTNAG 1 cut(s) 325
BstF5I GGATG 1 cut(s) 241
BstKTI GATC 5 cut(s) 141, 367, 376, 478, 484
BstMAI GTCTC 1 cut(s) 102
BstMBI GATC 5 cut(s) 138, 364, 373, 475, 481
BstMCI CGRYCG 1 cut(s) 124
BstNI CCWGG 1 cut(s) 18
BstSCI CCNGG 2 cut(s) 16, 118
BstV1I GCAGC 3 cut(s) 177, 469, 472
BstV2I GAAGAC 2 cut(s) 60, 118
BstX2I RGATCY 1 cut(s) 481
BstYI RGATCY 1 cut(s) 481
Bsu15I ATCGAT 1 cut(s) 91
BsuRI GGCC 2 cut(s) 281, 395
BsuTUI ATCGAT 1 cut(s) 91
BtsCI GGATG 1 cut(s) 241
CciI TCATGA 2 cut(s) 343, 370
ClaI ATCGAT 1 cut(s) 91
CsiI ACCWGGT 1 cut(s) 16
Csp6I GTAC 2 cut(s) 192, 442
CviAII CATG 2 cut(s) 344, 371
CviJI RGCY 7 cut(s) 70, 175, 246, 281, 329, 395, 463
CviKI_1 RGCY 7 cut(s) 70, 175, 246, 281, 329, 395, 463
CviQI GTAC 2 cut(s) 192, 442
DdeI CTNAG 1 cut(s) 325
DpnI GATC 5 cut(s) 140, 366, 375, 477, 483
DpnII GATC 5 cut(s) 138, 364, 373, 475, 481
DrdI GACNNNNNNGTC 1 cut(s) 120
DseDI GACNNNNNNGTC 1 cut(s) 120
Eco130I CCWWGG 1 cut(s) 396
Eco147I AGGCCT 1 cut(s) 395
Eco31I GGTCTC 1 cut(s) 102
EcoRII CCWGG 1 cut(s) 16
EcoT14I CCWWGG 1 cut(s) 396
ErhI CCWWGG 1 cut(s) 396
FaeI CATG 2 cut(s) 347, 374
FaiI YATR 6 cut(s) 23, 38, 308, 345, 372, 378
FatI CATG 2 cut(s) 343, 370
FbaI TGATCA 1 cut(s) 373
Fnu4HI GCNGC 3 cut(s) 166, 458, 461
FokI GGATG 1 cut(s) 248
Fsp4HI GCNGC 3 cut(s) 166, 458, 461
FspBI CTAG 1 cut(s) 210
GluI GCNGC 3 cut(s) 166, 458, 461
HaeIII GGCC 2 cut(s) 281, 395
HapII CCGG 1 cut(s) 120
Hin1II CATG 2 cut(s) 347, 374
HincII GTYRAC 1 cut(s) 514
HindII GTYRAC 1 cut(s) 514
HinfI GANTC 3 cut(s) 114, 503, 515
HpaII CCGG 1 cut(s) 120
Hpy166II GTNNAC 1 cut(s) 514
Hpy188I TCNGA 1 cut(s) 14
Hpy188III TCNNGA 7 cut(s) 44, 142, 229, 344, 371, 479, 485
Hpy8I GTNNAC 1 cut(s) 514
HpyAV CCTTC 2 cut(s) 212, 226
HpyCH4V TGCA 2 cut(s) 296, 350
HpyF3I CTNAG 1 cut(s) 325
Hsp92II CATG 2 cut(s) 347, 374
Ksp22I TGATCA 1 cut(s) 373
Kzo9I GATC 5 cut(s) 138, 364, 373, 475, 481
LpnPI CCDG 8 cut(s) 3, 30, 57, 68, 93, 133, 136, 171
Lsp1109I GCAGC 3 cut(s) 177, 469, 472
LweI GCATC 1 cut(s) 337
MabI ACCWGGT 1 cut(s) 16
MaeI CTAG 1 cut(s) 210
MaeIII GTNAC 1 cut(s) 32
MalI GATC 5 cut(s) 140, 366, 375, 477, 483
MboI GATC 5 cut(s) 138, 364, 373, 475, 481
MboII GAAGA 3 cut(s) 65, 123, 359
MflI RGATCY 1 cut(s) 481
MluCI AATT 2 cut(s) 102, 332
MlyI GAGTC 2 cut(s) 108, 509
MmeI TCCRAC 1 cut(s) 37
MnlI CCTC 8 cut(s) 23, 43, 60, 194, 236, 346, 385, 439
MseI TTAA 2 cut(s) 261, 529
MslI CAYNNNNRTG 1 cut(s) 345
MspI CCGG 1 cut(s) 120
MspR9I CCNGG 2 cut(s) 18, 120
MvaI CCWGG 1 cut(s) 18
NciI CCSGG 1 cut(s) 120
NdeII GATC 5 cut(s) 138, 364, 373, 475, 481
NlaIII CATG 2 cut(s) 347, 374
PagI TCATGA 2 cut(s) 343, 370
PceI AGGCCT 1 cut(s) 395
PfeI GAWTC 1 cut(s) 503
PkrI GCNGC 3 cut(s) 167, 459, 462
PleI GAGTC 2 cut(s) 108, 509
PpsI GAGTC 2 cut(s) 108, 509
Psp6I CCWGG 1 cut(s) 16
PspGI CCWGG 1 cut(s) 16
PsuI RGATCY 1 cut(s) 481
RsaI GTAC 2 cut(s) 193, 443
RsaNI GTAC 2 cut(s) 192, 442
RseI CAYNNNNRTG 1 cut(s) 345
SaqAI TTAA 2 cut(s) 261, 529
SatI GCNGC 3 cut(s) 166, 458, 461
Sau3AI GATC 5 cut(s) 138, 364, 373, 475, 481
ScaI AGTACT 1 cut(s) 193
SchI GAGTC 2 cut(s) 108, 509
ScrFI CCNGG 2 cut(s) 18, 120
SetI ASST 9 cut(s) 22, 34, 60, 205, 261, 267, 331, 357, 465
SexAI ACCWGGT 1 cut(s) 16
SfaNI GCATC 1 cut(s) 337
SmiMI CAYNNNNRTG 1 cut(s) 345
SmlI CTYRAG 2 cut(s) 227, 467
SmoI CTYRAG 2 cut(s) 227, 467
Sse9I AATT 2 cut(s) 102, 332
SseBI AGGCCT 1 cut(s) 395
SsiI CCGC 1 cut(s) 163
SspMI CTAG 1 cut(s) 210
StuI AGGCCT 1 cut(s) 395
StyD4I CCNGG 2 cut(s) 16, 118
StyI CCWWGG 1 cut(s) 396
TaqI TCGA 4 cut(s) 91, 124, 286, 486
TaqII GACCGA 1 cut(s) 255
TasI AATT 2 cut(s) 102, 332
TatI WGTACW 1 cut(s) 191
TfiI GAWTC 1 cut(s) 503
Tru1I TTAA 2 cut(s) 261, 529
Tru9I TTAA 2 cut(s) 261, 529
TseI GCWGC 3 cut(s) 165, 457, 460
TspDTI ATGAA 5 cut(s) 17, 62, 257, 359, 485
XspI CTAG 1 cut(s) 210
ZrmI AGTACT 1 cut(s) 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.