MD13G1034600.v1.1
MYB Family

Response regulator receiver domain

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
Physical Location & Seq
Forward (+)
2430165 .. 2431255
1091 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1034600.v1.1.491

Sequence Viewer

Length: 135 bp
ATGGAACACATGAGCCCTAAAAAGACTAATGGTCTCCCTAGCTTTGCACATGACCTCCAAATCTTGGTGGTAGATCATGATACATTGTCCCTCATGTCCACAGCGGCAACTCATGTCCTCAGAAGTGAATATTAA

Protein Analysis

45

Amino Acids

4.92

Weight (kDa)

5.98

Isoelectric Point (pI)

61.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017654)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g26570
malus_domestica MD13G1034600.v1.1 MD16G1036100.v1.1
prunus_persica Prupe.1G317900_v2.0.a1
rosa_laevigata RLG00000006691
rosa_multiflora Rmu_sc0000459.1_g000011
rosa_roxburghii Rroxscaffold_5G00375600
rosa_samantha Rh4AG330200 Rh4BG337800 Rh4CG353200 Rh4DG333800
rosa_wichuraiana Rw4G028640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 64
AciI CCGC 1 cut(s) 104
AfiI CCNNNNNNNGG 1 cut(s) 64
AhdI GACNNNNNGTC 1 cut(s) 30
AluBI AGCT 1 cut(s) 42
AluI AGCT 1 cut(s) 42
Alw26I GTCTC 1 cut(s) 38
BanII GRGCYC 1 cut(s) 17
BcoDI GTCTC 1 cut(s) 38
BfaI CTAG 1 cut(s) 39
BisI GCNGC 1 cut(s) 105
BlsI GCNGC 1 cut(s) 106
BmeRI GACNNNNNGTC 1 cut(s) 30
BsaI GGTCTC 1 cut(s) 38
BsaXI ACNNNNNCTCC 2 cut(s) 39, 69
Bsc4I CCNNNNNNNGG 1 cut(s) 64
BseLI CCNNNNNNNGG 1 cut(s) 64
BseMII CTCAG 1 cut(s) 133
BslFI GGGAC 1 cut(s) 73
BslI CCNNNNNNNGG 1 cut(s) 64
BsmAI GTCTC 1 cut(s) 38
BsmFI GGGAC 1 cut(s) 73
Bso31I GGTCTC 1 cut(s) 38
Bsp1286I GDGCHC 1 cut(s) 17
Bsp143I GATC 1 cut(s) 73
BspACI CCGC 1 cut(s) 104
BspCNI CTCAG 1 cut(s) 132
BspHI TCATGA 1 cut(s) 76
BspTNI GGTCTC 1 cut(s) 38
BssMI GATC 1 cut(s) 73
BstDEI CTNAG 1 cut(s) 119
BstKTI GATC 1 cut(s) 76
BstMAI GTCTC 1 cut(s) 38
BstMBI GATC 1 cut(s) 73
CciI TCATGA 1 cut(s) 76
CviAII CATG 5 cut(s) 10, 50, 77, 94, 113
CviJI RGCY 2 cut(s) 15, 42
CviKI_1 RGCY 2 cut(s) 15, 42
DdeI CTNAG 1 cut(s) 119
DpnI GATC 1 cut(s) 75
DpnII GATC 1 cut(s) 73
DriI GACNNNNNGTC 1 cut(s) 30
Eam1105I GACNNNNNGTC 1 cut(s) 30
Eco24I GRGCYC 1 cut(s) 17
Eco31I GGTCTC 1 cut(s) 38
EcoT38I GRGCYC 1 cut(s) 17
FaeI CATG 5 cut(s) 13, 53, 80, 97, 116
FaiI YATR 5 cut(s) 11, 51, 78, 95, 114
FaqI GGGAC 1 cut(s) 73
FatI CATG 5 cut(s) 9, 49, 76, 93, 112
Fnu4HI GCNGC 1 cut(s) 105
FriOI GRGCYC 1 cut(s) 17
Fsp4HI GCNGC 1 cut(s) 105
FspBI CTAG 1 cut(s) 39
GluI GCNGC 1 cut(s) 105
Hin1II CATG 5 cut(s) 13, 53, 80, 97, 116
Hpy166II GTNNAC 1 cut(s) 99
Hpy188I TCNGA 1 cut(s) 122
Hpy188III TCNNGA 1 cut(s) 77
Hpy8I GTNNAC 1 cut(s) 99
HpyCH4V TGCA 1 cut(s) 47
HpyF3I CTNAG 1 cut(s) 119
Hsp92II CATG 5 cut(s) 13, 53, 80, 97, 116
Kzo9I GATC 1 cut(s) 73
MaeI CTAG 1 cut(s) 39
MalI GATC 1 cut(s) 75
MboI GATC 1 cut(s) 73
MhlI GDGCHC 1 cut(s) 17
MnlI CCTC 3 cut(s) 65, 101, 128
MseI TTAA 1 cut(s) 133
MspA1I CMGCKG 1 cut(s) 104
NdeII GATC 1 cut(s) 73
NlaIII CATG 5 cut(s) 13, 53, 80, 97, 116
PagI TCATGA 1 cut(s) 76
PflMI CCANNNNNTGG 1 cut(s) 64
PkrI GCNGC 1 cut(s) 106
SaqAI TTAA 1 cut(s) 133
SatI GCNGC 1 cut(s) 105
Sau3AI GATC 1 cut(s) 73
SduI GDGCHC 1 cut(s) 17
SetI ASST 2 cut(s) 44, 57
SgeI CNNG 7 cut(s) 22, 51, 62, 76, 89, 106, 125
SsiI CCGC 1 cut(s) 104
SspI AATATT 1 cut(s) 131
SspMI CTAG 1 cut(s) 39
TauI GCSGC 1 cut(s) 107
Tru1I TTAA 1 cut(s) 133
Tru9I TTAA 1 cut(s) 133
Van91I CCANNNNNTGG 1 cut(s) 64
XspI CTAG 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.