Rmu_ssc0000434.1_g000060
MYB Family

ubiquitin modification-dependent histone binding

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000434.1
Physical Location & Seq
Reverse (-)
246985 .. 247314
330 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000434.1_g000060.1.cds

Sequence Viewer

Length: 330 bp
atggcaggaactagtgatcaatggactagggaagaaaacaaagctttcgaggttgccctagcggcaaactggaactgcattgagaaaggagaatgggagaagattgcttcatcgattccggggaaatccattgatcaaataaaagcacacttccggcagctgttggatgatgtagcagccatcgaggatgaccaagtaccctttcctagttatgcagatgaagattatccgatcaaggaagtcagaagtggcgtccaggatggtaaagattttggtggtgagccaaaagcggtgaaaagacaagccaagtcagtgaagaaaactaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

109

Amino Acids

12.18

Weight (kDa)

5.21

Isoelectric Point (pI)

40.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018070)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 62, 290
AcyI GRCGYC 1 cut(s) 252
AfaI GTAC 1 cut(s) 198
AhlI ACTAGT 1 cut(s) 11
AjnI CCWGG 1 cut(s) 255
AjuI GAANNNNNNNTTGG 2 cut(s) 186, 218
AluBI AGCT 2 cut(s) 44, 160
AluI AGCT 2 cut(s) 44, 160
ApeKI GCWGC 2 cut(s) 157, 176
AsuC2I CCSGG 1 cut(s) 120
AsuHPI GGTGA 2 cut(s) 290, 304
BbvI GCAGC 2 cut(s) 169, 188
BccI CCATC 2 cut(s) 188, 254
BciT130I CCWGG 1 cut(s) 257
BclI TGATCA 2 cut(s) 16, 133
BcnI CCSGG 1 cut(s) 120
BcuI ACTAGT 1 cut(s) 11
BfaI CTAG 4 cut(s) 12, 27, 59, 207
BglI GCCNNNNNGGC 1 cut(s) 62
BisI GCNGC 3 cut(s) 63, 158, 177
BlsI GCNGC 3 cut(s) 64, 159, 178
Bme1390I CCNGG 2 cut(s) 120, 257
BmrFI CCNGG 2 cut(s) 120, 257
BpuMI CCSGG 1 cut(s) 120
Bsa29I ATCGAT 1 cut(s) 113
BsaHI GRCGYC 1 cut(s) 252
BsaJI CCNNGG 1 cut(s) 119
Bse1I ACTGG 1 cut(s) 74
BseBI CCWGG 1 cut(s) 257
BseCI ATCGAT 1 cut(s) 113
BseDI CCNNGG 1 cut(s) 119
BseGI GGATG 3 cut(s) 172, 193, 265
BseNI ACTGG 1 cut(s) 74
BseXI GCAGC 2 cut(s) 169, 188
BshVI ATCGAT 1 cut(s) 113
BsiSI CCGG 2 cut(s) 119, 154
Bsp143I GATC 3 cut(s) 16, 133, 231
BspACI CCGC 2 cut(s) 62, 290
BspDI ATCGAT 1 cut(s) 113
BsrI ACTGG 1 cut(s) 74
BssECI CCNNGG 1 cut(s) 119
BssMI GATC 3 cut(s) 16, 133, 231
BssNI GRCGYC 1 cut(s) 252
Bst2UI CCWGG 1 cut(s) 257
BstACI GRCGYC 1 cut(s) 252
BstF5I GGATG 3 cut(s) 172, 193, 265
BstKTI GATC 3 cut(s) 19, 136, 234
BstMBI GATC 3 cut(s) 16, 133, 231
BstMWI GCNNNNNNNGC 1 cut(s) 62
BstNI CCWGG 1 cut(s) 257
BstSCI CCNGG 2 cut(s) 118, 255
BstV1I GCAGC 2 cut(s) 169, 188
Bsu15I ATCGAT 1 cut(s) 113
BsuTUI ATCGAT 1 cut(s) 113
BtsCI GGATG 3 cut(s) 172, 193, 265
BtsIMutI CAGTG 1 cut(s) 318
ClaI ATCGAT 1 cut(s) 113
CseI GACGC 1 cut(s) 241
Csp6I GTAC 1 cut(s) 197
CviJI RGCY 5 cut(s) 44, 160, 179, 283, 305
CviKI_1 RGCY 5 cut(s) 44, 160, 179, 283, 305
CviQI GTAC 1 cut(s) 197
DpnI GATC 3 cut(s) 18, 135, 233
DpnII GATC 3 cut(s) 16, 133, 231
EcoRII CCWGG 1 cut(s) 255
FaiI YATR 1 cut(s) 213
FbaI TGATCA 2 cut(s) 16, 133
Fnu4HI GCNGC 3 cut(s) 63, 158, 177
FokI GGATG 3 cut(s) 179, 200, 272
Fsp4HI GCNGC 3 cut(s) 63, 158, 177
FspBI CTAG 4 cut(s) 12, 27, 59, 207
GluI GCNGC 3 cut(s) 63, 158, 177
HapII CCGG 2 cut(s) 119, 154
HgaI GACGC 1 cut(s) 241
Hin1I GRCGYC 1 cut(s) 252
HindIII AAGCTT 1 cut(s) 42
HinfI GANTC 1 cut(s) 115
HpaII CCGG 2 cut(s) 119, 154
HphI GGTGA 2 cut(s) 290, 304
Hpy188I TCNGA 2 cut(s) 231, 245
HpyCH4V TGCA 2 cut(s) 78, 215
HpyF10VI GCNNNNNNNGC 1 cut(s) 62
Hsp92I GRCGYC 1 cut(s) 252
Ksp22I TGATCA 2 cut(s) 16, 133
Kzo9I GATC 3 cut(s) 16, 133, 231
LpnPI CCDG 5 cut(s) 55, 132, 167, 242, 269
Lsp1109I GCAGC 2 cut(s) 169, 188
MaeI CTAG 4 cut(s) 12, 27, 59, 207
MalI GATC 3 cut(s) 18, 135, 233
MboI GATC 3 cut(s) 16, 133, 231
MboII GAAGA 4 cut(s) 44, 112, 233, 328
MmeI TCCRAC 1 cut(s) 144
MnlI CCTC 2 cut(s) 43, 178
MspA1I CMGCKG 1 cut(s) 160
MspI CCGG 2 cut(s) 119, 154
MspR9I CCNGG 2 cut(s) 120, 257
MvaI CCWGG 1 cut(s) 257
MwoI GCNNNNNNNGC 1 cut(s) 62
NciI CCSGG 1 cut(s) 120
NdeII GATC 3 cut(s) 16, 133, 231
PfeI GAWTC 1 cut(s) 115
PfoI TCCNGGA 1 cut(s) 255
PkrI GCNGC 3 cut(s) 64, 159, 178
Psp6I CCWGG 1 cut(s) 255
PspGI CCWGG 1 cut(s) 255
PvuII CAGCTG 1 cut(s) 160
RsaI GTAC 1 cut(s) 198
RsaNI GTAC 1 cut(s) 197
SatI GCNGC 3 cut(s) 63, 158, 177
Sau3AI GATC 3 cut(s) 16, 133, 231
ScrFI CCNGG 2 cut(s) 120, 257
SetI ASST 3 cut(s) 46, 54, 162
SpeI ACTAGT 1 cut(s) 11
SsiI CCGC 2 cut(s) 62, 290
SspMI CTAG 4 cut(s) 12, 27, 59, 207
StyD4I CCNGG 2 cut(s) 118, 255
TaqI TCGA 3 cut(s) 48, 113, 183
TauI GCSGC 1 cut(s) 65
TfiI GAWTC 1 cut(s) 115
TscAI CASTG 1 cut(s) 318
TseI GCWGC 2 cut(s) 157, 176
TspDTI ATGAA 2 cut(s) 99, 234
TspRI CASTG 1 cut(s) 318
XspI CTAG 4 cut(s) 12, 27, 59, 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.