FvH4_7g08710
MYB Family

ubiquitin modification-dependent histone binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb7
OG0018070
Physical Location & Seq
Forward (+)
8521095 .. 8521418
324 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_7g08710.t1

Sequence Viewer

Length: 324 bp
ATGGCAGGAACTAGTGATGATCGATGGACTAGGGAAGAAAACAAAGCTTTCGAGGTTGCCCTAGCGGCAAACTGGAACAACATTGAGAAAGGGGAATGGGAGAAAATTGCTTCATCGATTCCGGGGAAATCCATTGATCAAATAAAAGCACAATTCCGGCGGCTGTTGGAAGATGTAGCAGCGATCGAAGATGACCGAGTGCCACTTCCTAGTTACGCAGATGAATATTATCCGATCAAGGAAGTGAGAAGTGTCGTCCAGGATGGTAAAGATTGTGGTGGTGAGCCAAAAGCGGCAGAGAGAAGAGATATTGAAGAAGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-binding

Protein Analysis

108

Amino Acids

12.16

Weight (kDa)

4.6

Isoelectric Point (pI)

66.31

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-binding PF00249 7 - 56 4.2e-06 Myb-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018070)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g08710
prunus_persica Prupe.2G114800_v2.0.a1
rosa_laevigata RLG00000028946
rosa_multiflora Rmu_sc0007696.1_g000013 Rmu_ssc0000434.1_g000060
rosa_roxburghii Rroxscaffold_4G00310270
rosa_rugosa Rorug01G0169600
rosa_samantha Rh1AG186100 Rh1BG152600 Rh1CG171800 Rh1DG185000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 65, 160, 293
AgsI TTSAA 1 cut(s) 314
AhlI ACTAGT 1 cut(s) 11
AjnI CCWGG 1 cut(s) 258
AluBI AGCT 1 cut(s) 47
AluI AGCT 1 cut(s) 47
ApeKI GCWGC 1 cut(s) 179
AsuC2I CCSGG 1 cut(s) 123
AsuHPI GGTGA 1 cut(s) 293
BbvI GCAGC 1 cut(s) 191
BccI CCATC 2 cut(s) 18, 257
BciT130I CCWGG 1 cut(s) 260
BclI TGATCA 1 cut(s) 136
BcnI CCSGG 1 cut(s) 123
BcuI ACTAGT 1 cut(s) 11
BfaI CTAG 4 cut(s) 12, 30, 62, 210
BglI GCCNNNNNGGC 1 cut(s) 65
BisI GCNGC 4 cut(s) 66, 161, 180, 294
BlsI GCNGC 4 cut(s) 67, 162, 181, 295
Bme1390I CCNGG 2 cut(s) 123, 260
BmrFI CCNGG 2 cut(s) 123, 260
BpuMI CCSGG 1 cut(s) 123
Bsa29I ATCGAT 2 cut(s) 22, 116
BsaJI CCNNGG 1 cut(s) 122
Bse1I ACTGG 1 cut(s) 77
BseBI CCWGG 1 cut(s) 260
BseCI ATCGAT 2 cut(s) 22, 116
BseDI CCNNGG 1 cut(s) 122
BseGI GGATG 1 cut(s) 268
BseNI ACTGG 1 cut(s) 77
BseXI GCAGC 1 cut(s) 191
Bsh1285I CGRYCG 1 cut(s) 186
BshVI ATCGAT 2 cut(s) 22, 116
BsiEI CGRYCG 1 cut(s) 186
BsiSI CCGG 2 cut(s) 122, 157
Bsp143I GATC 4 cut(s) 19, 136, 183, 234
BspACI CCGC 3 cut(s) 65, 160, 293
BspDI ATCGAT 2 cut(s) 22, 116
BsrI ACTGG 1 cut(s) 77
BssECI CCNNGG 1 cut(s) 122
BssMI GATC 4 cut(s) 19, 136, 183, 234
Bst2UI CCWGG 1 cut(s) 260
Bst6I CTCTTC 2 cut(s) 298, 312
BstF5I GGATG 1 cut(s) 268
BstKTI GATC 4 cut(s) 22, 139, 186, 237
BstMBI GATC 4 cut(s) 19, 136, 183, 234
BstMCI CGRYCG 1 cut(s) 186
BstMWI GCNNNNNNNGC 1 cut(s) 65
BstNI CCWGG 1 cut(s) 260
BstSCI CCNGG 2 cut(s) 121, 258
BstV1I GCAGC 1 cut(s) 191
Bsu15I ATCGAT 2 cut(s) 22, 116
BsuTUI ATCGAT 2 cut(s) 22, 116
BtsCI GGATG 1 cut(s) 268
ClaI ATCGAT 2 cut(s) 22, 116
CviJI RGCY 3 cut(s) 47, 163, 286
CviKI_1 RGCY 3 cut(s) 47, 163, 286
DpnI GATC 4 cut(s) 21, 138, 185, 236
DpnII GATC 4 cut(s) 19, 136, 183, 234
Eam1104I CTCTTC 2 cut(s) 298, 312
EarI CTCTTC 2 cut(s) 298, 312
EcoRII CCWGG 1 cut(s) 258
FbaI TGATCA 1 cut(s) 136
Fnu4HI GCNGC 4 cut(s) 66, 161, 180, 294
FokI GGATG 1 cut(s) 275
Fsp4HI GCNGC 4 cut(s) 66, 161, 180, 294
FspBI CTAG 4 cut(s) 12, 30, 62, 210
GluI GCNGC 4 cut(s) 66, 161, 180, 294
HapII CCGG 2 cut(s) 122, 157
HindIII AAGCTT 1 cut(s) 45
HinfI GANTC 1 cut(s) 118
HpaII CCGG 2 cut(s) 122, 157
HphI GGTGA 1 cut(s) 293
Hpy188I TCNGA 1 cut(s) 234
HpyF10VI GCNNNNNNNGC 1 cut(s) 65
Ksp22I TGATCA 1 cut(s) 136
Kzo9I GATC 4 cut(s) 19, 136, 183, 234
LpnPI CCDG 5 cut(s) 58, 135, 170, 245, 272
Lsp1109I GCAGC 1 cut(s) 191
MaeI CTAG 4 cut(s) 12, 30, 62, 210
MaeIII GTNAC 1 cut(s) 212
MalI GATC 4 cut(s) 21, 138, 185, 236
MboI GATC 4 cut(s) 19, 136, 183, 234
MboII GAAGA 4 cut(s) 47, 182, 200, 315
MluCI AATT 2 cut(s) 105, 152
MmeI TCCRAC 1 cut(s) 147
MnlI CCTC 1 cut(s) 46
MspI CCGG 2 cut(s) 122, 157
MspR9I CCNGG 2 cut(s) 123, 260
MvaI CCWGG 1 cut(s) 260
MwoI GCNNNNNNNGC 1 cut(s) 65
NciI CCSGG 1 cut(s) 123
NdeII GATC 4 cut(s) 19, 136, 183, 234
PfeI GAWTC 1 cut(s) 118
PfoI TCCNGGA 1 cut(s) 258
PkrI GCNGC 4 cut(s) 67, 162, 181, 295
Ple19I CGATCG 1 cut(s) 186
Psp6I CCWGG 1 cut(s) 258
PspGI CCWGG 1 cut(s) 258
PvuI CGATCG 1 cut(s) 186
SatI GCNGC 4 cut(s) 66, 161, 180, 294
Sau3AI GATC 4 cut(s) 19, 136, 183, 234
ScrFI CCNGG 2 cut(s) 123, 260
SetI ASST 2 cut(s) 49, 57
SpeI ACTAGT 1 cut(s) 11
Sse9I AATT 2 cut(s) 105, 152
SsiI CCGC 3 cut(s) 65, 160, 293
SspI AATATT 1 cut(s) 227
SspMI CTAG 4 cut(s) 12, 30, 62, 210
StyD4I CCNGG 2 cut(s) 121, 258
TaqI TCGA 4 cut(s) 22, 51, 116, 186
TaqII GACCGA 1 cut(s) 210
TasI AATT 2 cut(s) 105, 152
TauI GCSGC 3 cut(s) 68, 163, 296
TfiI GAWTC 1 cut(s) 118
TseI GCWGC 1 cut(s) 179
TspDTI ATGAA 2 cut(s) 102, 237
XspI CTAG 4 cut(s) 12, 30, 62, 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.