Prupe.2G114800_v2.0.a1
MYB Family

ubiquitin modification-dependent histone binding

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Forward (+)
17262091 .. 17262396
306 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G114800.1

Sequence Viewer

Length: 306 bp
ATGGCAGGAGCCATTGATGAATGGACAAGGGAAGAAAATAAAGCCTTCGAGATTGCCATAGCCACCTACAACATTGAATGCATTGAAAAAGGGGAGTGGGAGAAAGTTTCTTTATCTGTTCCTGGAAAATCTATTGATCAAATAAAACTACACTTCATGCACCTATTGATGGATGTGGAGGCCATCGAGTCCGACCAAGGACCACTTCCTGATTACGAGTATGATGAAGACGAGAATGATGGTGACGATGGAAACGATGGTGATCATGGTGATAACAAAGAGAAAGAGATGTCGATCGTGCCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

11.42

Weight (kDa)

4.08

Isoelectric Point (pI)

49.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018070)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 169
AgsI TTSAA 2 cut(s) 77, 86
AjnI CCWGG 1 cut(s) 121
AjuI GAANNNNNNNTTGG 2 cut(s) 189, 221
AoxI GGCC 1 cut(s) 180
AspS9I GGNCC 1 cut(s) 200
AsuHPI GGTGA 3 cut(s) 254, 272, 281
AvaII GGWCC 1 cut(s) 200
BbsI GAAGAC 1 cut(s) 234
BccI CCATC 5 cut(s) 163, 191, 233, 242, 251
BciT130I CCWGG 1 cut(s) 123
BclI TGATCA 2 cut(s) 136, 262
Bme1390I CCNGG 1 cut(s) 123
Bme18I GGWCC 1 cut(s) 200
BmgT120I GGNCC 1 cut(s) 200
BmiI GGNNCC 1 cut(s) 10
BmrFI CCNGG 1 cut(s) 123
BpiI GAAGAC 1 cut(s) 234
BsaBI GATNNNNATC 2 cut(s) 261, 293
BsaJI CCNNGG 1 cut(s) 196
Bsc4I CCNNNNNNNGG 1 cut(s) 169
Bse8I GATNNNNATC 2 cut(s) 261, 293
BseBI CCWGG 1 cut(s) 123
BseDI CCNNGG 1 cut(s) 196
BseGI GGATG 1 cut(s) 178
BseJI GATNNNNATC 2 cut(s) 261, 293
BseLI CCNNNNNNNGG 1 cut(s) 169
Bsh1285I CGRYCG 1 cut(s) 297
BshFI GGCC 1 cut(s) 182
BsiEI CGRYCG 1 cut(s) 297
BslI CCNNNNNNNGG 1 cut(s) 169
BsmI GAATGC 1 cut(s) 83
BsnI GGCC 1 cut(s) 182
Bsp143I GATC 3 cut(s) 136, 262, 294
BspANI GGCC 1 cut(s) 182
BspLI GGNNCC 1 cut(s) 10
BssECI CCNNGG 1 cut(s) 196
BssMI GATC 3 cut(s) 136, 262, 294
BssT1I CCWWGG 1 cut(s) 196
Bst2UI CCWGG 1 cut(s) 123
BstF5I GGATG 1 cut(s) 178
BstKTI GATC 3 cut(s) 139, 265, 297
BstMBI GATC 3 cut(s) 136, 262, 294
BstMCI CGRYCG 1 cut(s) 297
BstNI CCWGG 1 cut(s) 123
BstSCI CCNGG 1 cut(s) 121
BstV2I GAAGAC 1 cut(s) 234
BsuRI GGCC 1 cut(s) 182
BtsCI GGATG 1 cut(s) 178
Cfr13I GGNCC 1 cut(s) 200
CviAII CATG 3 cut(s) 157, 266, 303
CviJI RGCY 4 cut(s) 11, 44, 62, 182
CviKI_1 RGCY 4 cut(s) 11, 44, 62, 182
DpnI GATC 3 cut(s) 138, 264, 296
DpnII GATC 3 cut(s) 136, 262, 294
Eco130I CCWWGG 1 cut(s) 196
Eco47I GGWCC 1 cut(s) 200
EcoRII CCWGG 1 cut(s) 121
EcoT14I CCWWGG 1 cut(s) 196
EcoT22I ATGCAT 1 cut(s) 83
ErhI CCWWGG 1 cut(s) 196
FaeI CATG 3 cut(s) 160, 269, 306
FaiI YATR 5 cut(s) 59, 158, 222, 267, 304
FalI AAGNNNNNCTT 2 cut(s) 189, 221
FatI CATG 3 cut(s) 156, 265, 302
FbaI TGATCA 2 cut(s) 136, 262
FokI GGATG 1 cut(s) 185
HaeIII GGCC 1 cut(s) 182
Hin1II CATG 3 cut(s) 160, 269, 306
HinfI GANTC 1 cut(s) 188
HphI GGTGA 3 cut(s) 254, 272, 281
Hpy188I TCNGA 1 cut(s) 193
Hpy188III TCNNGA 2 cut(s) 49, 209
HpyAV CCTTC 1 cut(s) 55
HpyCH4V TGCA 2 cut(s) 81, 160
Hsp92II CATG 3 cut(s) 160, 269, 306
Ksp22I TGATCA 2 cut(s) 136, 262
Kzo9I GATC 3 cut(s) 136, 262, 294
LmnI GCTCC 1 cut(s) 8
LpnPI CCDG 3 cut(s) 108, 135, 222
MaeIII GTNAC 1 cut(s) 242
MalI GATC 3 cut(s) 138, 264, 296
MboI GATC 3 cut(s) 136, 262, 294
MboII GAAGA 2 cut(s) 44, 239
MlyI GAGTC 1 cut(s) 197
MmeI TCCRAC 1 cut(s) 216
MnlI CCTC 1 cut(s) 172
Mph1103I ATGCAT 1 cut(s) 83
MspR9I CCNGG 1 cut(s) 123
Mva1269I GAATGC 1 cut(s) 83
MvaI CCWGG 1 cut(s) 123
NdeII GATC 3 cut(s) 136, 262, 294
NlaIII CATG 3 cut(s) 160, 269, 306
NlaIV GGNNCC 1 cut(s) 10
NmuCI GTSAC 1 cut(s) 242
NsiI ATGCAT 1 cut(s) 83
PcsI WCGNNNNNNNCGW 1 cut(s) 252
PctI GAATGC 1 cut(s) 83
PfoI TCCNGGA 1 cut(s) 121
Ple19I CGATCG 1 cut(s) 297
PleI GAGTC 1 cut(s) 196
PpsI GAGTC 1 cut(s) 196
Psp6I CCWGG 1 cut(s) 121
PspGI CCWGG 1 cut(s) 121
PspN4I GGNNCC 1 cut(s) 10
PspPI GGNCC 1 cut(s) 200
PvuI CGATCG 1 cut(s) 297
Sau3AI GATC 3 cut(s) 136, 262, 294
Sau96I GGNCC 1 cut(s) 200
SchI GAGTC 1 cut(s) 197
ScrFI CCNGG 1 cut(s) 123
SetI ASST 2 cut(s) 68, 165
SinI GGWCC 1 cut(s) 200
StyD4I CCNGG 1 cut(s) 121
StyI CCWWGG 1 cut(s) 196
TaqI TCGA 3 cut(s) 48, 186, 293
TseFI GTSAC 1 cut(s) 242
Tsp45I GTSAC 1 cut(s) 242
TspDTI ATGAA 3 cut(s) 33, 145, 240
VpaK11BI GGWCC 1 cut(s) 200
Zsp2I ATGCAT 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.