Rh3CG137000
MYB Family

cell division cycle 5-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
11242168 .. 11242391
224 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG137000.1

Sequence Viewer

Length: 195 bp
ATGGGACATGACGATAAATCCCTCGATGAATTTGTTGAAATACAAAAGACATGCCACAATGCTTATGGTGCATCAAGTATTGCTGGAAATGAAAAGAAACTTAGGGCTCTGCAGAATGAGTTTGAGAATGTAAGGAAGAAGTTGGATGATGATCTTGGGAAGGCAGCGAGCCTTGAAGAAAAGGTCAAGGTCTGA

Protein Analysis

64

Amino Acids

7.16

Weight (kDa)

5.6

Isoelectric Point (pI)

25.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020071)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 29
AgsI TTSAA 2 cut(s) 38, 176
ApeKI GCWGC 1 cut(s) 164
ApoI RAATTY 1 cut(s) 29
BanII GRGCYC 1 cut(s) 109
BbvI GCAGC 1 cut(s) 176
BfmI CTRYAG 1 cut(s) 110
BisI GCNGC 1 cut(s) 165
BlsI GCNGC 1 cut(s) 166
BmsI GCATC 1 cut(s) 80
BsaBI GATNNNNATC 1 cut(s) 150
Bse8I GATNNNNATC 1 cut(s) 150
BseGI GGATG 1 cut(s) 151
BseJI GATNNNNATC 1 cut(s) 150
BseXI GCAGC 1 cut(s) 176
BslFI GGGAC 1 cut(s) 18
BsmFI GGGAC 1 cut(s) 18
Bsp1286I GDGCHC 1 cut(s) 109
Bsp143I GATC 1 cut(s) 151
BspMAI CTGCAG 1 cut(s) 114
BssMI GATC 1 cut(s) 151
BstC8I GCNNGC 1 cut(s) 169
BstDEI CTNAG 1 cut(s) 101
BstF5I GGATG 1 cut(s) 151
BstKTI GATC 1 cut(s) 154
BstMBI GATC 1 cut(s) 151
BstMWI GCNNNNNNNGC 1 cut(s) 68
BstNSI RCATGY 1 cut(s) 54
BstSFI CTRYAG 1 cut(s) 110
BstV1I GCAGC 1 cut(s) 176
BtsCI GGATG 1 cut(s) 151
Cac8I GCNNGC 1 cut(s) 169
CviAII CATG 2 cut(s) 8, 51
CviJI RGCY 2 cut(s) 107, 171
CviKI_1 RGCY 2 cut(s) 107, 171
DdeI CTNAG 1 cut(s) 101
DpnI GATC 1 cut(s) 153
DpnII GATC 1 cut(s) 151
Eco24I GRGCYC 1 cut(s) 109
EcoT38I GRGCYC 1 cut(s) 109
FaeI CATG 2 cut(s) 11, 54
FaiI YATR 3 cut(s) 9, 52, 66
FaqI GGGAC 1 cut(s) 18
FatI CATG 2 cut(s) 7, 50
Fnu4HI GCNGC 1 cut(s) 165
FokI GGATG 1 cut(s) 158
FriOI GRGCYC 1 cut(s) 109
Fsp4HI GCNGC 1 cut(s) 165
GluI GCNGC 1 cut(s) 165
Hin1II CATG 2 cut(s) 11, 54
Hpy188I TCNGA 1 cut(s) 194
HpyAV CCTTC 1 cut(s) 154
HpyCH4V TGCA 2 cut(s) 71, 112
HpyF10VI GCNNNNNNNGC 1 cut(s) 68
HpyF3I CTNAG 1 cut(s) 101
Hsp92II CATG 2 cut(s) 11, 54
Kzo9I GATC 1 cut(s) 151
LpnPI CCDG 1 cut(s) 69
Lsp1109I GCAGC 1 cut(s) 176
LweI GCATC 1 cut(s) 80
MalI GATC 1 cut(s) 153
MboI GATC 1 cut(s) 151
MboII GAAGA 2 cut(s) 148, 188
MhlI GDGCHC 1 cut(s) 109
MluCI AATT 1 cut(s) 29
MmeI TCCRAC 1 cut(s) 123
MnlI CCTC 1 cut(s) 32
MwoI GCNNNNNNNGC 1 cut(s) 68
NdeII GATC 1 cut(s) 151
NlaIII CATG 2 cut(s) 11, 54
NspI RCATGY 1 cut(s) 54
PkrI GCNGC 1 cut(s) 166
PstI CTGCAG 1 cut(s) 114
SatI GCNGC 1 cut(s) 165
Sau3AI GATC 1 cut(s) 151
SduI GDGCHC 1 cut(s) 109
SetI ASST 2 cut(s) 186, 192
SfaNI GCATC 1 cut(s) 80
SfcI CTRYAG 1 cut(s) 110
SgeI CNNG 8 cut(s) 20, 35, 63, 87, 96, 167, 180, 185
Sse9I AATT 1 cut(s) 29
TaqI TCGA 1 cut(s) 24
TasI AATT 1 cut(s) 29
TseI GCWGC 1 cut(s) 164
TspDTI ATGAA 2 cut(s) 42, 105
XapI RAATTY 1 cut(s) 29
XceI RCATGY 1 cut(s) 54
XcmI CCANNNNNNNNNTGG 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.