Rh3BG134500
MYB Family

cell division cycle 5-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
11391051 .. 11391875
825 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG134500.1

Sequence Viewer

Length: 363 bp
ATGGGACATGACGATAAATCCCTCGATGAATTTGTTGAAATACAAAAGACATGCCACAATGCTTATGGTGCATCAAGTATTGCTGGAAATGAAAAGAAACTTAGGGCTCTGCAGAATGAGTTTGAGAATGTAAGGAAGAAGTTGGATGATGATCTTGGGAAGGCAGCGAGCCTTGAAGAAAAGGTCAAGGTACATTACTCAATCCAATCATGCTTCCCAAATATTCTCTTATTAATTGGCAATGGGGGCTGTAGTGGAGTTATACCTGACCTAGATCCTGGAATACTAGTGGAGGAAAGAGGTGTTCATTTGGAGGTACAAGCAATGAGAGAACAACATGAGGCTGATATTGAAACGATTTGA

Protein Analysis

120

Amino Acids

13.27

Weight (kDa)

4.92

Isoelectric Point (pI)

40.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020071)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 269
AcsI RAATTY 1 cut(s) 29
AfaI GTAC 2 cut(s) 192, 318
AgsI TTSAA 3 cut(s) 38, 176, 353
AhlI ACTAGT 1 cut(s) 286
AjnI CCWGG 1 cut(s) 277
AlwI GGATC 1 cut(s) 269
ApeKI GCWGC 1 cut(s) 164
ApoI RAATTY 1 cut(s) 29
AseI ATTAAT 1 cut(s) 233
BanII GRGCYC 1 cut(s) 109
BbvI GCAGC 1 cut(s) 176
BciT130I CCWGG 1 cut(s) 279
BcuI ACTAGT 1 cut(s) 286
BfaI CTAG 2 cut(s) 272, 287
BfmI CTRYAG 2 cut(s) 110, 250
BisI GCNGC 1 cut(s) 165
BlsI GCNGC 1 cut(s) 166
Bme1390I CCNGG 1 cut(s) 279
BmrFI CCNGG 1 cut(s) 279
BmsI GCATC 1 cut(s) 80
BsaBI GATNNNNATC 1 cut(s) 150
Bse3DI GCAATG 2 cut(s) 247, 330
Bse8I GATNNNNATC 1 cut(s) 150
BseBI CCWGG 1 cut(s) 279
BseGI GGATG 1 cut(s) 151
BseJI GATNNNNATC 1 cut(s) 150
BseMI GCAATG 2 cut(s) 247, 330
BseXI GCAGC 1 cut(s) 176
BslFI GGGAC 1 cut(s) 18
BsmFI GGGAC 1 cut(s) 18
Bsp1286I GDGCHC 1 cut(s) 109
Bsp143I GATC 2 cut(s) 151, 274
BspMAI CTGCAG 1 cut(s) 114
BspPI GGATC 1 cut(s) 269
BsrDI GCAATG 2 cut(s) 247, 330
BssMI GATC 2 cut(s) 151, 274
Bst2UI CCWGG 1 cut(s) 279
BstC8I GCNNGC 1 cut(s) 169
BstDEI CTNAG 1 cut(s) 101
BstF5I GGATG 1 cut(s) 151
BstKTI GATC 2 cut(s) 154, 277
BstMBI GATC 2 cut(s) 151, 274
BstMWI GCNNNNNNNGC 2 cut(s) 68, 246
BstNI CCWGG 1 cut(s) 279
BstNSI RCATGY 1 cut(s) 54
BstSCI CCNGG 1 cut(s) 277
BstSFI CTRYAG 2 cut(s) 110, 250
BstV1I GCAGC 1 cut(s) 176
BstX2I RGATCY 1 cut(s) 274
BstYI RGATCY 1 cut(s) 274
BtsCI GGATG 1 cut(s) 151
Cac8I GCNNGC 1 cut(s) 169
Csp6I GTAC 2 cut(s) 191, 317
CviAII CATG 4 cut(s) 8, 51, 210, 338
CviJI RGCY 4 cut(s) 107, 171, 249, 344
CviKI_1 RGCY 4 cut(s) 107, 171, 249, 344
CviQI GTAC 2 cut(s) 191, 317
DdeI CTNAG 1 cut(s) 101
DpnI GATC 2 cut(s) 153, 276
DpnII GATC 2 cut(s) 151, 274
Eco24I GRGCYC 1 cut(s) 109
EcoRII CCWGG 1 cut(s) 277
EcoT38I GRGCYC 1 cut(s) 109
FaeI CATG 4 cut(s) 11, 54, 213, 341
FaiI YATR 6 cut(s) 9, 52, 66, 211, 263, 339
FaqI GGGAC 1 cut(s) 18
FatI CATG 4 cut(s) 7, 50, 209, 337
Fnu4HI GCNGC 1 cut(s) 165
FokI GGATG 1 cut(s) 158
FriOI GRGCYC 1 cut(s) 109
Fsp4HI GCNGC 1 cut(s) 165
FspBI CTAG 2 cut(s) 272, 287
GluI GCNGC 1 cut(s) 165
Hin1II CATG 4 cut(s) 11, 54, 213, 341
HpyAV CCTTC 1 cut(s) 154
HpyCH4V TGCA 2 cut(s) 71, 112
HpyF10VI GCNNNNNNNGC 2 cut(s) 68, 246
HpyF3I CTNAG 1 cut(s) 101
Hsp92II CATG 4 cut(s) 11, 54, 213, 341
Kzo9I GATC 2 cut(s) 151, 274
LpnPI CCDG 4 cut(s) 69, 264, 279, 291
Lsp1109I GCAGC 1 cut(s) 176
LweI GCATC 1 cut(s) 80
MaeI CTAG 2 cut(s) 272, 287
MalI GATC 2 cut(s) 153, 276
MboI GATC 2 cut(s) 151, 274
MboII GAAGA 2 cut(s) 148, 188
MflI RGATCY 1 cut(s) 274
MhlI GDGCHC 1 cut(s) 109
MluCI AATT 2 cut(s) 29, 234
MmeI TCCRAC 1 cut(s) 123
MnlI CCTC 5 cut(s) 32, 286, 293, 307, 334
MseI TTAA 1 cut(s) 233
MspR9I CCNGG 1 cut(s) 279
MvaI CCWGG 1 cut(s) 279
MwoI GCNNNNNNNGC 2 cut(s) 68, 246
NdeII GATC 2 cut(s) 151, 274
NlaIII CATG 4 cut(s) 11, 54, 213, 341
NspI RCATGY 1 cut(s) 54
PfoI TCCNGGA 1 cut(s) 277
PkrI GCNGC 1 cut(s) 166
PshBI ATTAAT 1 cut(s) 233
Psp6I CCWGG 1 cut(s) 277
PspGI CCWGG 1 cut(s) 277
PstI CTGCAG 1 cut(s) 114
PsuI RGATCY 1 cut(s) 274
RsaI GTAC 2 cut(s) 192, 318
RsaNI GTAC 2 cut(s) 191, 317
SaqAI TTAA 1 cut(s) 233
SatI GCNGC 1 cut(s) 165
Sau3AI GATC 2 cut(s) 151, 274
ScrFI CCNGG 1 cut(s) 279
SduI GDGCHC 1 cut(s) 109
SetI ASST 6 cut(s) 186, 192, 268, 273, 304, 318
SfaNI GCATC 1 cut(s) 80
SfcI CTRYAG 2 cut(s) 110, 250
SpeI ACTAGT 1 cut(s) 286
Sse9I AATT 2 cut(s) 29, 234
SspI AATATT 1 cut(s) 223
SspMI CTAG 2 cut(s) 272, 287
StyD4I CCNGG 1 cut(s) 277
TaqI TCGA 1 cut(s) 24
TasI AATT 2 cut(s) 29, 234
Tru1I TTAA 1 cut(s) 233
Tru9I TTAA 1 cut(s) 233
TseI GCWGC 1 cut(s) 164
TspDTI ATGAA 3 cut(s) 42, 105, 296
VspI ATTAAT 1 cut(s) 233
XapI RAATTY 1 cut(s) 29
XceI RCATGY 1 cut(s) 54
XcmI CCANNNNNNNNNTGG 1 cut(s) 62
XspI CTAG 2 cut(s) 272, 287
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.