Rmu_sc0020230.1_g000001
MYB Family

SANT SWI3, ADA2, N-CoR and TFIIIB'' DNA-binding domains

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0020230.1
OG0020670
Physical Location & Seq
Forward (+)
1 .. 2858
2858 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0020230.1_g000001.1.cds

Sequence Viewer

Length: 349 bp
gtttgatgcgaaaaagtgtgcaactgattgttttggcgctgttcctttgtctgttgtgttgcactattttatttccttatttttattcagattgaacaaaactaatatgggaaggaaggagaggacacctttggagtttgaatcaggaaaagagaagaaaaaacacaaggagaaaaggaaggagaaatcaaagaaggatgaacttgaaagaaattcttccgtgcttgaagtctgtggggacaaaatgggcaaggaagttgaggggctgaaatatgacaagactgctggaaatcatatgaatagtggagaagaagccaataagaaaaagaaaaggaggggaatgatatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_6 Myb_DNA-binding

Protein Analysis

115

Amino Acids

13.24

Weight (kDa)

9.66

Isoelectric Point (pI)

37.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020670)

Species Orthologous Gene IDs
rosa_laevigata RLG00000018573
rosa_multiflora Rmu_sc0020230.1_g000001
rosa_roxburghii Rroxscaffold_165G00437070 Rroxscaffold_3G00235940 Rroxscaffold_6G00425270
rosa_samantha Rh7DG350900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 212
AgsI TTSAA 4 cut(s) 95, 141, 207, 228
ApoI RAATTY 1 cut(s) 212
Asp700I GAANNNNTTC 1 cut(s) 215
AspLEI GCGC 1 cut(s) 39
BfoI RGCGCY 1 cut(s) 40
BseGI GGATG 1 cut(s) 203
BslFI GGGAC 1 cut(s) 252
BsmFI GGGAC 1 cut(s) 252
BstF5I GGATG 1 cut(s) 203
BstH2I RGCGCY 1 cut(s) 40
BstHHI GCGC 1 cut(s) 39
BtsCI GGATG 1 cut(s) 203
CfoI GCGC 1 cut(s) 39
CviJI RGCY 2 cut(s) 266, 315
CviKI_1 RGCY 2 cut(s) 266, 315
FaiI YATR 5 cut(s) 108, 274, 295, 297, 347
FalI AAGNNNNNCTT 2 cut(s) 200, 232
FaqI GGGAC 1 cut(s) 252
FauNDI CATATG 1 cut(s) 295
FokI GGATG 1 cut(s) 210
GlaI GCGC 1 cut(s) 38
HaeII RGCGCY 1 cut(s) 40
HhaI GCGC 1 cut(s) 39
Hin6I GCGC 1 cut(s) 37
HinP1I GCGC 1 cut(s) 37
HinfI GANTC 1 cut(s) 141
Hpy188I TCNGA 1 cut(s) 90
Hpy188III TCNNGA 1 cut(s) 145
HpyAV CCTTC 4 cut(s) 106, 110, 173, 188
HpyCH4V TGCA 2 cut(s) 21, 62
HspAI GCGC 1 cut(s) 37
LpnPI CCDG 2 cut(s) 130, 271
MboII GAAGA 3 cut(s) 167, 208, 321
MluCI AATT 1 cut(s) 212
MnlI CCTC 3 cut(s) 115, 254, 328
MroXI GAANNNNTTC 1 cut(s) 215
NdeI CATATG 1 cut(s) 295
PdmI GAANNNNTTC 1 cut(s) 215
PfeI GAWTC 1 cut(s) 141
SetI ASST 1 cut(s) 131
SgeI CNNG 8 cut(s) 157, 179, 216, 233, 237, 263, 290, 298
Sse9I AATT 1 cut(s) 212
TasI AATT 1 cut(s) 212
TfiI GAWTC 1 cut(s) 141
TspDTI ATGAA 2 cut(s) 214, 312
TspGWI ACGGA 1 cut(s) 209
XapI RAATTY 1 cut(s) 212
XmnI GAANNNNTTC 1 cut(s) 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.