FvH4_1g13280
MYB Family

SANT SWI3, ADA2, N-CoR and TFIIIB'' DNA-binding domains

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
OG0017220
Physical Location & Seq
Reverse (-)
7286359 .. 7288936
2578 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g13280.t1

Sequence Viewer

Length: 294 bp
ATGGTATCTAACAAGCTGTCGTACCCAGACTCCAGCTCAACTTGGACAGCCAAGCAAACCAAATTGTTCGAAAATGCTCTCGCAATCTATGATCAGGAAACCAATGACCGTTGGCACAAGATAGCCAAGATCGTTGGAGGGACAACTGAAGAAGAAGTGAAGAGGCAGTATGAGATCCTAGTACACGACATCAACTGCATAGAGTCAGGCAAAGTTCCCCTTCCTAAATACAGGAAAGTAGGAGAAAGCAAGATCAGCAATCAGGAAAAGAGGCTGAAGAGTTTAAAGCTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-binding

Protein Analysis

98

Amino Acids

11.18

Weight (kDa)

9.21

Isoelectric Point (pI)

49.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-binding PF00249 14 - 57 8.1e-06 Myb-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017220)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g13280 FvH4_1g13280
malus_domestica MD02G1147200.v1.1
prunus_persica Prupe.7G155000_v2.0.a1
rosa_laevigata RLG00000017084
rosa_multiflora Rmu_sc0006153.1_g000020
rosa_roxburghii Rroxscaffold_2G00141250
rosa_rugosa Rorug02G0097900
rosa_samantha Rh2AG147600 Rh2BG152800 Rh2CG153600 Rh2DG153000
rosa_wichuraiana Rw2G011500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 169
AcuI CTGAAG 1 cut(s) 168
AfaI GTAC 2 cut(s) 23, 183
AluBI AGCT 3 cut(s) 16, 36, 289
AluI AGCT 3 cut(s) 16, 36, 289
AlwI GGATC 1 cut(s) 169
AsuII TTCGAA 1 cut(s) 69
BclI TGATCA 1 cut(s) 91
BfaI CTAG 1 cut(s) 179
BpmI CTGGAG 1 cut(s) 16
Bpu14I TTCGAA 1 cut(s) 69
BsaXI ACNNNNNCTCC 2 cut(s) 14, 44
BslFI GGGAC 1 cut(s) 154
BsmFI GGGAC 1 cut(s) 154
Bsp119I TTCGAA 1 cut(s) 69
Bsp143I GATC 4 cut(s) 91, 129, 174, 252
BspPI GGATC 1 cut(s) 169
BspT104I TTCGAA 1 cut(s) 69
BssMI GATC 4 cut(s) 91, 129, 174, 252
Bst4CI ACNGT 1 cut(s) 110
Bst6I CTCTTC 2 cut(s) 155, 272
BstBI TTCGAA 1 cut(s) 69
BstKTI GATC 4 cut(s) 94, 132, 177, 255
BstMBI GATC 4 cut(s) 91, 129, 174, 252
BstMWI GCNNNNNNNGC 1 cut(s) 255
BstX2I RGATCY 1 cut(s) 174
BstYI RGATCY 1 cut(s) 174
Csp6I GTAC 2 cut(s) 22, 182
CviJI RGCY 6 cut(s) 16, 36, 50, 125, 274, 289
CviKI_1 RGCY 6 cut(s) 16, 36, 50, 125, 274, 289
CviQI GTAC 2 cut(s) 22, 182
DpnI GATC 4 cut(s) 93, 131, 176, 254
DpnII GATC 4 cut(s) 91, 129, 174, 252
DraI TTTAAA 1 cut(s) 285
Eam1104I CTCTTC 2 cut(s) 155, 272
EarI CTCTTC 2 cut(s) 155, 272
Eco57I CTGAAG 1 cut(s) 168
FaiI YATR 4 cut(s) 90, 171, 200, 292
FalI AAGNNNNNCTT 2 cut(s) 204, 236
FaqI GGGAC 1 cut(s) 154
FbaI TGATCA 1 cut(s) 91
FspBI CTAG 1 cut(s) 179
GsuI CTGGAG 1 cut(s) 16
HinfI GANTC 2 cut(s) 29, 203
Hpy166II GTNNAC 1 cut(s) 184
Hpy188III TCNNGA 2 cut(s) 95, 263
Hpy8I GTNNAC 1 cut(s) 184
HpyAV CCTTC 1 cut(s) 230
HpyCH4III ACNGT 1 cut(s) 110
HpyCH4V TGCA 1 cut(s) 198
HpyF10VI GCNNNNNNNGC 1 cut(s) 255
Ksp22I TGATCA 1 cut(s) 91
Kzo9I GATC 4 cut(s) 91, 129, 174, 252
LpnPI CCDG 6 cut(s) 39, 46, 80, 192, 217, 248
MaeI CTAG 1 cut(s) 179
MalI GATC 4 cut(s) 93, 131, 176, 254
MboI GATC 4 cut(s) 91, 129, 174, 252
MboII GAAGA 4 cut(s) 161, 164, 172, 289
MflI RGATCY 1 cut(s) 174
MluCI AATT 1 cut(s) 62
MlyI GAGTC 2 cut(s) 23, 212
MmeI TCCRAC 1 cut(s) 115
MnlI CCTC 3 cut(s) 131, 156, 264
MseI TTAA 1 cut(s) 284
MwoI GCNNNNNNNGC 1 cut(s) 255
NdeII GATC 4 cut(s) 91, 129, 174, 252
NspV TTCGAA 1 cut(s) 69
PleI GAGTC 2 cut(s) 23, 211
PpsI GAGTC 2 cut(s) 23, 211
PsuI RGATCY 1 cut(s) 174
RsaI GTAC 2 cut(s) 23, 183
RsaNI GTAC 2 cut(s) 22, 182
SaqAI TTAA 1 cut(s) 284
Sau3AI GATC 4 cut(s) 91, 129, 174, 252
SchI GAGTC 2 cut(s) 23, 212
SetI ASST 3 cut(s) 18, 38, 291
SfuI TTCGAA 1 cut(s) 69
Sse9I AATT 1 cut(s) 62
SspMI CTAG 1 cut(s) 179
TaaI ACNGT 1 cut(s) 110
TaqI TCGA 1 cut(s) 69
TasI AATT 1 cut(s) 62
TatI WGTACW 1 cut(s) 181
Tru1I TTAA 1 cut(s) 284
Tru9I TTAA 1 cut(s) 284
XspI CTAG 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.