Rmu_sc0014424.1_g000001
MYB Family

SWI SNF complex subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014424.1
Physical Location & Seq
Forward (+)
1 .. 496
496 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014424.1_g000001.1.cds

Sequence Viewer

Length: 286 bp
gatgaacttggagagcatgcatggtcaaggtggcgctcataaaaatattgcaaattcagttcagcagaaggatgagaaatcagcaggacaaggttcttggggtaaaaatgaggcaggggcgactccagtacctgcagaaaaagttaaagctgctgccaaagctggccttgctgctgctgcaataaaagcaaaattgtttgctgatcatgaagaacgggaaattcagaggttatctgctaatattgtaaatcatcaggtaaatctagtgcttactgcaattttctaa

Protein Analysis

94

Amino Acids

9.88

Weight (kDa)

9.1

Isoelectric Point (pI)

33.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0031478)

Species Orthologous Gene IDs
rosa_multiflora Rmu_co8221840.1_g000001 Rmu_sc0014424.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 140
AcsI RAATTY 2 cut(s) 53, 220
AfaI GTAC 1 cut(s) 130
AluBI AGCT 2 cut(s) 150, 162
AluI AGCT 2 cut(s) 150, 162
AlwNI CAGNNNCTG 1 cut(s) 132
AoxI GGCC 1 cut(s) 164
ApeKI GCWGC 5 cut(s) 150, 153, 171, 174, 177
ApoI RAATTY 2 cut(s) 53, 220
AspLEI GCGC 1 cut(s) 36
BaeI ACNNNNGTAYC 2 cut(s) 112, 145
BbvI GCAGC 5 cut(s) 137, 140, 158, 161, 164
BclI TGATCA 1 cut(s) 203
BfaI CTAG 1 cut(s) 264
BfmI CTRYAG 1 cut(s) 133
BfoI RGCGCY 1 cut(s) 37
BfuAI ACCTGC 1 cut(s) 140
BisI GCNGC 5 cut(s) 151, 154, 172, 175, 178
BlsI GCNGC 5 cut(s) 152, 155, 173, 176, 179
BpmI CTGGAG 1 cut(s) 109
Bse1I ACTGG 1 cut(s) 126
BseGI GGATG 1 cut(s) 77
BseNI ACTGG 1 cut(s) 126
BseXI GCAGC 5 cut(s) 137, 140, 158, 161, 164
BshFI GGCC 1 cut(s) 166
BsnI GGCC 1 cut(s) 166
Bsp143I GATC 1 cut(s) 203
BspANI GGCC 1 cut(s) 166
BspHI TCATGA 1 cut(s) 206
BspMAI CTGCAG 1 cut(s) 137
BspMI ACCTGC 1 cut(s) 140
BsrI ACTGG 1 cut(s) 126
BssMI GATC 1 cut(s) 203
BstC8I GCNNGC 2 cut(s) 18, 164
BstF5I GGATG 1 cut(s) 77
BstH2I RGCGCY 1 cut(s) 37
BstHHI GCGC 1 cut(s) 36
BstKTI GATC 1 cut(s) 206
BstMBI GATC 1 cut(s) 203
BstMWI GCNNNNNNNGC 4 cut(s) 159, 168, 177, 186
BstNSI RCATGY 1 cut(s) 20
BstSFI CTRYAG 1 cut(s) 133
BstV1I GCAGC 5 cut(s) 137, 140, 158, 161, 164
BsuRI GGCC 1 cut(s) 166
BtsCI GGATG 1 cut(s) 77
BveI ACCTGC 1 cut(s) 140
Cac8I GCNNGC 2 cut(s) 18, 164
CaiI CAGNNNCTG 1 cut(s) 132
CciI TCATGA 1 cut(s) 206
CfoI GCGC 1 cut(s) 36
Csp6I GTAC 1 cut(s) 129
CviAII CATG 3 cut(s) 17, 21, 207
CviJI RGCY 3 cut(s) 150, 162, 166
CviKI_1 RGCY 3 cut(s) 150, 162, 166
CviQI GTAC 1 cut(s) 129
DpnI GATC 1 cut(s) 205
DpnII GATC 1 cut(s) 203
EcoT22I ATGCAT 1 cut(s) 22
FaeI CATG 3 cut(s) 20, 24, 210
FaiI YATR 4 cut(s) 18, 22, 40, 208
FalI AAGNNNNNCTT 2 cut(s) 151, 183
FatI CATG 3 cut(s) 16, 20, 206
FbaI TGATCA 1 cut(s) 203
Fnu4HI GCNGC 5 cut(s) 151, 154, 172, 175, 178
FokI GGATG 1 cut(s) 84
Fsp4HI GCNGC 5 cut(s) 151, 154, 172, 175, 178
FspBI CTAG 1 cut(s) 264
GlaI GCGC 1 cut(s) 35
GluI GCNGC 5 cut(s) 151, 154, 172, 175, 178
GsuI CTGGAG 1 cut(s) 109
HaeII RGCGCY 1 cut(s) 37
HaeIII GGCC 1 cut(s) 166
HhaI GCGC 1 cut(s) 36
Hin1II CATG 3 cut(s) 20, 24, 210
Hin6I GCGC 1 cut(s) 34
HinP1I GCGC 1 cut(s) 34
HinfI GANTC 1 cut(s) 122
Hpy188I TCNGA 1 cut(s) 226
Hpy188III TCNNGA 1 cut(s) 207
HpyAV CCTTC 1 cut(s) 62
HpyCH4V TGCA 5 cut(s) 20, 51, 135, 180, 276
HpyF10VI GCNNNNNNNGC 4 cut(s) 159, 168, 177, 186
Hsp92II CATG 3 cut(s) 20, 24, 210
HspAI GCGC 1 cut(s) 34
Ksp22I TGATCA 1 cut(s) 203
Kzo9I GATC 1 cut(s) 203
LpnPI CCDG 6 cut(s) 70, 100, 139, 145, 148, 240
Lsp1109I GCAGC 5 cut(s) 137, 140, 158, 161, 164
MaeI CTAG 1 cut(s) 264
MalI GATC 1 cut(s) 205
MboI GATC 1 cut(s) 203
MboII GAAGA 1 cut(s) 222
MluCI AATT 4 cut(s) 53, 192, 220, 277
MlyI GAGTC 1 cut(s) 116
MnlI CCTC 2 cut(s) 104, 220
Mph1103I ATGCAT 1 cut(s) 22
MseI TTAA 1 cut(s) 145
MwoI GCNNNNNNNGC 4 cut(s) 159, 168, 177, 186
NdeII GATC 1 cut(s) 203
NlaIII CATG 3 cut(s) 20, 24, 210
NsiI ATGCAT 1 cut(s) 22
NspI RCATGY 1 cut(s) 20
PaeI GCATGC 1 cut(s) 20
PagI TCATGA 1 cut(s) 206
PkrI GCNGC 5 cut(s) 152, 155, 173, 176, 179
PleI GAGTC 1 cut(s) 116
PpsI GAGTC 1 cut(s) 116
PstI CTGCAG 1 cut(s) 137
PstNI CAGNNNCTG 1 cut(s) 132
RsaI GTAC 1 cut(s) 130
RsaNI GTAC 1 cut(s) 129
SaqAI TTAA 1 cut(s) 145
SatI GCNGC 5 cut(s) 151, 154, 172, 175, 178
Sau3AI GATC 1 cut(s) 203
SchI GAGTC 1 cut(s) 116
SetI ASST 7 cut(s) 32, 95, 134, 152, 164, 231, 259
SfcI CTRYAG 1 cut(s) 133
SphI GCATGC 1 cut(s) 20
Sse9I AATT 4 cut(s) 53, 192, 220, 277
SspI AATATT 2 cut(s) 47, 242
SspMI CTAG 1 cut(s) 264
TasI AATT 4 cut(s) 53, 192, 220, 277
Tru1I TTAA 1 cut(s) 145
Tru9I TTAA 1 cut(s) 145
TseI GCWGC 5 cut(s) 150, 153, 171, 174, 177
TspDTI ATGAA 2 cut(s) 18, 223
XapI RAATTY 2 cut(s) 53, 220
XceI RCATGY 1 cut(s) 20
XspI CTAG 1 cut(s) 264
Zsp2I ATGCAT 1 cut(s) 22
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.