Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8221840.1

Orthogroup ID

OG0031478

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 702

Gene Structure 702 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8221840.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 240 bp

atgcatggtcaaggtggcgctcataaaaatattgcaaattcagttcagcagaaggatgagaaatcagcaggacaaggttcttggggtaaaaatgaggcaggggcgactccagtacctgcagaaaaagttaaagctgctgccaaagctggccttgctgctgctgcaataaaagcaaaattgtttgctgatcatgaagaacgggaaattcagaggttatctgctaatattgtaaatcatcag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000228 GO:0000785 GO:0000790 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005694 GO:0006325 GO:0006338 GO:0006996 GO:0008150 GO:0009987 GO:0016043 GO:0016514 GO:0031974 GO:0031981 GO:0032991 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0044422 GO:0044424 GO:0044427 GO:0044428 GO:0044446 GO:0044454 GO:0044464 GO:0051276 GO:0070013 GO:0070603 GO:0071840 GO:1902494 GO:1904949

KEGG Pathways

Metabolic & Signaling

ko04714 ko05225 map04714 map05225

Pfam Domains

Protein Families

Myb_DNA-binding SWIRM SWIRM-assoc_1

Protein Analysis

80

Amino Acids

8.34

Weight (kDa)

9.46

Isoelectric Point (pI)

36.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031478)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_co8221840.1_g000001 Rmu_sc0014424.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	124
AcsI	RAATTY	2 cut(s)	37, 204
AfaI	GTAC	1 cut(s)	114
AluBI	AGCT	2 cut(s)	134, 146
AluI	AGCT	2 cut(s)	134, 146
AlwNI	CAGNNNCTG	1 cut(s)	116
AoxI	GGCC	1 cut(s)	148
ApeKI	GCWGC	5 cut(s)	134, 137, 155, 158, 161
ApoI	RAATTY	2 cut(s)	37, 204
AspLEI	GCGC	1 cut(s)	20
BaeI	ACNNNNGTAYC	2 cut(s)	96, 129
BbvI	GCAGC	5 cut(s)	121, 124, 142, 145, 148
BclI	TGATCA	1 cut(s)	187
BfmI	CTRYAG	1 cut(s)	117
BfoI	RGCGCY	1 cut(s)	21
BfuAI	ACCTGC	1 cut(s)	124
BisI	GCNGC	5 cut(s)	135, 138, 156, 159, 162
BlsI	GCNGC	5 cut(s)	136, 139, 157, 160, 163
BpmI	CTGGAG	1 cut(s)	93
Bse1I	ACTGG	1 cut(s)	110
BseGI	GGATG	1 cut(s)	61
BseNI	ACTGG	1 cut(s)	110
BseXI	GCAGC	5 cut(s)	121, 124, 142, 145, 148
BshFI	GGCC	1 cut(s)	150
BsnI	GGCC	1 cut(s)	150
Bsp143I	GATC	1 cut(s)	187
BspANI	GGCC	1 cut(s)	150
BspHI	TCATGA	1 cut(s)	190
BspMAI	CTGCAG	1 cut(s)	121
BspMI	ACCTGC	1 cut(s)	124
BsrI	ACTGG	1 cut(s)	110
BssMI	GATC	1 cut(s)	187
BstC8I	GCNNGC	1 cut(s)	148
BstF5I	GGATG	1 cut(s)	61
BstH2I	RGCGCY	1 cut(s)	21
BstHHI	GCGC	1 cut(s)	20
BstKTI	GATC	1 cut(s)	190
BstMBI	GATC	1 cut(s)	187
BstMWI	GCNNNNNNNGC	4 cut(s)	143, 152, 161, 170
BstSFI	CTRYAG	1 cut(s)	117
BstV1I	GCAGC	5 cut(s)	121, 124, 142, 145, 148
BsuRI	GGCC	1 cut(s)	150
BtsCI	GGATG	1 cut(s)	61
BveI	ACCTGC	1 cut(s)	124
Cac8I	GCNNGC	1 cut(s)	148
CaiI	CAGNNNCTG	1 cut(s)	116
CciI	TCATGA	1 cut(s)	190
CfoI	GCGC	1 cut(s)	20
Csp6I	GTAC	1 cut(s)	113
CviAII	CATG	2 cut(s)	5, 191
CviJI	RGCY	3 cut(s)	134, 146, 150
CviKI_1	RGCY	3 cut(s)	134, 146, 150
CviQI	GTAC	1 cut(s)	113
DpnI	GATC	1 cut(s)	189
DpnII	GATC	1 cut(s)	187
EcoT22I	ATGCAT	1 cut(s)	6
FaeI	CATG	2 cut(s)	8, 194
FaiI	YATR	3 cut(s)	6, 24, 192
FalI	AAGNNNNNCTT	2 cut(s)	135, 167
FatI	CATG	2 cut(s)	4, 190
FbaI	TGATCA	1 cut(s)	187
Fnu4HI	GCNGC	5 cut(s)	135, 138, 156, 159, 162
FokI	GGATG	1 cut(s)	68
Fsp4HI	GCNGC	5 cut(s)	135, 138, 156, 159, 162
GlaI	GCGC	1 cut(s)	19
GluI	GCNGC	5 cut(s)	135, 138, 156, 159, 162
GsuI	CTGGAG	1 cut(s)	93
HaeII	RGCGCY	1 cut(s)	21
HaeIII	GGCC	1 cut(s)	150
HhaI	GCGC	1 cut(s)	20
Hin1II	CATG	2 cut(s)	8, 194
Hin6I	GCGC	1 cut(s)	18
HinP1I	GCGC	1 cut(s)	18
HinfI	GANTC	1 cut(s)	106
Hpy188I	TCNGA	1 cut(s)	210
Hpy188III	TCNNGA	1 cut(s)	191
HpyAV	CCTTC	1 cut(s)	46
HpyCH4V	TGCA	4 cut(s)	4, 35, 119, 164
HpyF10VI	GCNNNNNNNGC	4 cut(s)	143, 152, 161, 170
Hsp92II	CATG	2 cut(s)	8, 194
HspAI	GCGC	1 cut(s)	18
Ksp22I	TGATCA	1 cut(s)	187
Kzo9I	GATC	1 cut(s)	187
LpnPI	CCDG	5 cut(s)	54, 84, 123, 129, 132
Lsp1109I	GCAGC	5 cut(s)	121, 124, 142, 145, 148
MalI	GATC	1 cut(s)	189
MboI	GATC	1 cut(s)	187
MboII	GAAGA	1 cut(s)	206
MluCI	AATT	3 cut(s)	37, 176, 204
MlyI	GAGTC	1 cut(s)	100
MnlI	CCTC	2 cut(s)	88, 204
Mph1103I	ATGCAT	1 cut(s)	6
MseI	TTAA	1 cut(s)	129
MwoI	GCNNNNNNNGC	4 cut(s)	143, 152, 161, 170
NdeII	GATC	1 cut(s)	187
NlaIII	CATG	2 cut(s)	8, 194
NsiI	ATGCAT	1 cut(s)	6
PagI	TCATGA	1 cut(s)	190
PkrI	GCNGC	5 cut(s)	136, 139, 157, 160, 163
PleI	GAGTC	1 cut(s)	100
PpsI	GAGTC	1 cut(s)	100
PstI	CTGCAG	1 cut(s)	121
PstNI	CAGNNNCTG	1 cut(s)	116
RsaI	GTAC	1 cut(s)	114
RsaNI	GTAC	1 cut(s)	113
SaqAI	TTAA	1 cut(s)	129
SatI	GCNGC	5 cut(s)	135, 138, 156, 159, 162
Sau3AI	GATC	1 cut(s)	187
SchI	GAGTC	1 cut(s)	100
SetI	ASST	6 cut(s)	16, 79, 118, 136, 148, 215
SfcI	CTRYAG	1 cut(s)	117
Sse9I	AATT	3 cut(s)	37, 176, 204
SspI	AATATT	2 cut(s)	31, 226
TasI	AATT	3 cut(s)	37, 176, 204
Tru1I	TTAA	1 cut(s)	129
Tru9I	TTAA	1 cut(s)	129
TseI	GCWGC	5 cut(s)	134, 137, 155, 158, 161
TspDTI	ATGAA	1 cut(s)	207
XapI	RAATTY	2 cut(s)	37, 204
Zsp2I	ATGCAT	1 cut(s)	6

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.