Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr14

Orthogroup ID

OG0028326

Physical Location & Seq

Genomic Coordinates Reverse (-)

21362825 .. 21363088

Gene Structure 264 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD14G1135000.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 156 bp

ATGCTTAACATGGGGAGAGCACCATGTTGTTCAAAGGTAGGACTGCATCGAGGTTCATGGACTGCCAGAGAAGACAAATTGCTTATTCAGTATATGAACTCCCATGGTGAAGGTCGTTGGAGTTCTTTACCTAAAAATGCTGTTGTTTTTGCTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Myb_DNA-binding

Protein Analysis

52

Amino Acids

5.7

Weight (kDa)

9.69

Isoelectric Point (pI)

27.02

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Myb_DNA-binding	PF00249	17 - 46	1.5e-07	Myb-like DNA-binding domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0028326)

Species	Orthologous Gene IDs
malus_domestica	MD14G1135000.v1.1
rosa_samantha	Rh4CG269200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	33
Alw21I	GWGCWC	1 cut(s)	22
AsuHPI	GGTGA	1 cut(s)	119
BbsI	GAAGAC	1 cut(s)	78
Bbv12I	GWGCWC	1 cut(s)	22
BmsI	GCATC	1 cut(s)	55
BpiI	GAAGAC	1 cut(s)	78
BsaJI	CCNNGG	1 cut(s)	103
BseDI	CCNNGG	1 cut(s)	103
BsiHKAI	GWGCWC	1 cut(s)	22
Bsp1286I	GDGCHC	1 cut(s)	22
Bsp19I	CCATGG	1 cut(s)	103
BssECI	CCNNGG	1 cut(s)	103
BssT1I	CCWWGG	1 cut(s)	103
BstDSI	CCRYGG	1 cut(s)	103
BstV2I	GAAGAC	1 cut(s)	78
BtgI	CCRYGG	1 cut(s)	103
CviAII	CATG	4 cut(s)	10, 24, 57, 104
Eco130I	CCWWGG	1 cut(s)	103
EcoT14I	CCWWGG	1 cut(s)	103
ErhI	CCWWGG	1 cut(s)	103
FaeI	CATG	4 cut(s)	13, 27, 60, 107
FaiI	YATR	6 cut(s)	11, 25, 58, 93, 95, 105
FatI	CATG	4 cut(s)	9, 23, 56, 103
Hin1II	CATG	4 cut(s)	13, 27, 60, 107
HphI	GGTGA	1 cut(s)	119
HpyAV	CCTTC	1 cut(s)	104
HpyCH4V	TGCA	1 cut(s)	46
Hsp92II	CATG	4 cut(s)	13, 27, 60, 107
LpnPI	CCDG	1 cut(s)	79
LweI	GCATC	1 cut(s)	55
MboII	GAAGA	1 cut(s)	83
MhlI	GDGCHC	1 cut(s)	22
MluCI	AATT	1 cut(s)	77
MmeI	TCCRAC	1 cut(s)	98
MnlI	CCTC	1 cut(s)	44
MseI	TTAA	2 cut(s)	6, 154
NcoI	CCATGG	1 cut(s)	103
NlaIII	CATG	4 cut(s)	13, 27, 60, 107
SaqAI	TTAA	2 cut(s)	6, 154
SduI	GDGCHC	1 cut(s)	22
SetI	ASST	4 cut(s)	39, 55, 115, 133
SfaNI	GCATC	1 cut(s)	55
SgeI	CNNG	6 cut(s)	22, 36, 62, 69, 78, 116
Sse9I	AATT	1 cut(s)	77
StyI	CCWWGG	1 cut(s)	103
TaqI	TCGA	1 cut(s)	49
TasI	AATT	1 cut(s)	77
Tru1I	TTAA	2 cut(s)	6, 154
Tru9I	TTAA	2 cut(s)	6, 154
TspDTI	ATGAA	2 cut(s)	45, 110

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.