MD10G1087000.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
OG0026649
Physical Location & Seq
Forward (+)
12901805 .. 12904879
3075 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1087000.v1.1.491

Sequence Viewer

Length: 258 bp
ATGGAAGTGGAAGGTGGGGAAGAAATGGAAGTGGATGAAGTGGACGAAGAAATGGAAGTGGAGCAAATGGTGGAAGAACAAATTGAAGAAGAAGAAGAAGAAACTAATGAAGAAGAAATTGAGGAAGAACTTTATGAAACCATTAAATATTTATTGATGGCAATTCAAGCTGTAGTCCACGTGCTAAAAGAGTTTATAATTACATTTGGACAACCTATTGAACGTCCTTTAAATCGAAGATCAATTACTATGGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

10.14

Weight (kDa)

4.05

Isoelectric Point (pI)

89.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0026649)

Species Orthologous Gene IDs
malus_domestica MD10G1087000.v1.1
rosa_roxburghii Rroxscaffold_1G00025780

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 197
AcvI CACGTG 1 cut(s) 181
AgsI TTSAA 3 cut(s) 86, 167, 221
AluBI AGCT 1 cut(s) 170
AluI AGCT 1 cut(s) 170
BarI GAAGNNNNNNTAC 1 cut(s) 229
BbrPI CACGTG 1 cut(s) 181
BccI CCATC 1 cut(s) 151
BfmI CTRYAG 1 cut(s) 171
BsaAI YACGTR 1 cut(s) 181
BseGI GGATG 1 cut(s) 40
Bsp143I GATC 1 cut(s) 239
BssMI GATC 1 cut(s) 239
BstBAI YACGTR 1 cut(s) 181
BstF5I GGATG 1 cut(s) 40
BstKTI GATC 1 cut(s) 242
BstMBI GATC 1 cut(s) 239
BstMWI GCNNNNNNNGC 1 cut(s) 167
BstSFI CTRYAG 1 cut(s) 171
BtsCI GGATG 1 cut(s) 40
CviJI RGCY 1 cut(s) 170
CviKI_1 RGCY 1 cut(s) 170
DpnI GATC 1 cut(s) 241
DpnII GATC 1 cut(s) 239
DraI TTTAAA 1 cut(s) 231
Eco72I CACGTG 1 cut(s) 181
FaiI YATR 3 cut(s) 135, 197, 251
FokI GGATG 1 cut(s) 47
Hpy166II GTNNAC 2 cut(s) 43, 178
Hpy8I GTNNAC 2 cut(s) 43, 178
HpyAV CCTTC 1 cut(s) 5
HpyCH4IV ACGT 2 cut(s) 180, 223
HpyF10VI GCNNNNNNNGC 1 cut(s) 167
HpySE526I ACGT 2 cut(s) 180, 223
Kzo9I GATC 1 cut(s) 239
LmnI GCTCC 1 cut(s) 61
MaeII ACGT 2 cut(s) 180, 223
MalI GATC 1 cut(s) 241
MboI GATC 1 cut(s) 239
MluCI AATT 5 cut(s) 81, 117, 162, 198, 243
MnlI CCTC 1 cut(s) 115
MseI TTAA 2 cut(s) 144, 230
MwoI GCNNNNNNNGC 1 cut(s) 167
NdeII GATC 1 cut(s) 239
PmaCI CACGTG 1 cut(s) 181
PmlI CACGTG 1 cut(s) 181
Ppu21I YACGTR 1 cut(s) 181
PsiI TTATAA 1 cut(s) 197
PspCI CACGTG 1 cut(s) 181
SaqAI TTAA 2 cut(s) 144, 230
Sau3AI GATC 1 cut(s) 239
SetI ASST 5 cut(s) 16, 172, 183, 217, 226
SfcI CTRYAG 1 cut(s) 171
SgeI CNNG 3 cut(s) 179, 191, 193
Sse9I AATT 5 cut(s) 81, 117, 162, 198, 243
SspI AATATT 1 cut(s) 149
TaiI ACGT 2 cut(s) 183, 226
TaqI TCGA 1 cut(s) 235
TasI AATT 5 cut(s) 81, 117, 162, 198, 243
Tru1I TTAA 2 cut(s) 144, 230
Tru9I TTAA 2 cut(s) 144, 230
TspDTI ATGAA 3 cut(s) 51, 123, 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.