Rh7CG414400
MYB Family

SANT SWI3, ADA2, N-CoR and TFIIIB'' DNA-binding domains

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0033769
Physical Location & Seq
Forward (+)
53236126 .. 53238975
2850 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG414400.1

Sequence Viewer

Length: 312 bp
ATGGCTATGGTTAAGAATGAAAGACTGCTCCGGCGCCATCGACCACTTCAGGCAAGTGATGTCCTTAATGTGGAGCTTTTGCAAAAAGATGCACGACTTGCCGTTAGTGGAGAGATAGGAAAGCCATGTCCTGGTGGAACCATGAAGTGGTATGACCAATTATTATCACCTTTGGCAAACCGAAAGCTGTGGGCTGATATTGATGACTATCGACTTCTTGATGCTCTCAATAGCTTGGATGCTTGCTGTATTGAAGATGTTGATTGGGATGATCTGCTTGAGCATAGGCTGGGAGAAATATACCAAAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_6 Myb_DNA-binding

Protein Analysis

103

Amino Acids

11.85

Weight (kDa)

4.89

Isoelectric Point (pI)

42.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0033769)

Species Orthologous Gene IDs
rosa_samantha Rh7AG395700 Rh7CG414400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 33
AccB7I CCANNNNNTGG 2 cut(s) 131, 147
AcuI CTGAAG 1 cut(s) 32
AcyI GRCGYC 1 cut(s) 34
AfiI CCNNNNNNNGG 3 cut(s) 70, 131, 147
AgsI TTSAA 1 cut(s) 254
AjnI CCWGG 1 cut(s) 130
AluBI AGCT 3 cut(s) 76, 187, 234
AluI AGCT 3 cut(s) 76, 187, 234
AspLEI GCGC 1 cut(s) 36
AsuHPI GGTGA 1 cut(s) 159
BanI GGYRCC 1 cut(s) 33
BccI CCATC 1 cut(s) 45
BceAI ACGGC 1 cut(s) 86
BciT130I CCWGG 1 cut(s) 132
BfoI RGCGCY 1 cut(s) 37
Bme1390I CCNGG 1 cut(s) 132
BmiI GGNNCC 2 cut(s) 35, 139
BmrFI CCNGG 1 cut(s) 132
BmsI GCATC 3 cut(s) 79, 211, 229
BpuEI CTTGAG 1 cut(s) 299
BsaBI GATNNNNATC 1 cut(s) 207
BsaHI GRCGYC 1 cut(s) 34
Bsc4I CCNNNNNNNGG 3 cut(s) 70, 131, 147
Bse8I GATNNNNATC 1 cut(s) 207
BseBI CCWGG 1 cut(s) 132
BseGI GGATG 2 cut(s) 244, 274
BseJI GATNNNNATC 1 cut(s) 207
BseLI CCNNNNNNNGG 3 cut(s) 70, 131, 147
BseYI CCCAGC 1 cut(s) 289
BshNI GGYRCC 1 cut(s) 33
BsiSI CCGG 1 cut(s) 31
BslI CCNNNNNNNGG 3 cut(s) 70, 131, 147
Bsp143I GATC 1 cut(s) 271
BspLI GGNNCC 2 cut(s) 35, 139
BspT107I GGYRCC 1 cut(s) 33
BssMI GATC 1 cut(s) 271
BssNI GRCGYC 1 cut(s) 34
Bst2UI CCWGG 1 cut(s) 132
BstACI GRCGYC 1 cut(s) 34
BstAPI GCANNNNNTGC 1 cut(s) 98
BstC8I GCNNGC 1 cut(s) 244
BstF5I GGATG 2 cut(s) 244, 274
BstH2I RGCGCY 1 cut(s) 37
BstHHI GCGC 1 cut(s) 36
BstKTI GATC 1 cut(s) 274
BstMBI GATC 1 cut(s) 271
BstMWI GCNNNNNNNGC 1 cut(s) 98
BstNI CCWGG 1 cut(s) 132
BstSCI CCNGG 1 cut(s) 130
BtsCI GGATG 2 cut(s) 244, 274
Cac8I GCNNGC 1 cut(s) 244
CfoI GCGC 1 cut(s) 36
CviAII CATG 2 cut(s) 126, 142
CviJI RGCY 7 cut(s) 5, 76, 124, 187, 194, 234, 289
CviKI_1 RGCY 7 cut(s) 5, 76, 124, 187, 194, 234, 289
DinI GGCGCC 1 cut(s) 35
DpnI GATC 1 cut(s) 273
DpnII GATC 1 cut(s) 271
Eco57I CTGAAG 1 cut(s) 32
EcoRII CCWGG 1 cut(s) 130
EgeI GGCGCC 1 cut(s) 35
EheI GGCGCC 1 cut(s) 35
FaeI CATG 2 cut(s) 129, 145
FaiI YATR 6 cut(s) 8, 127, 143, 153, 285, 301
FatI CATG 2 cut(s) 125, 141
FokI GGATG 2 cut(s) 251, 281
GlaI GCGC 1 cut(s) 35
GsaI CCCAGC 1 cut(s) 293
HaeII RGCGCY 1 cut(s) 37
HapII CCGG 1 cut(s) 31
HhaI GCGC 1 cut(s) 36
Hin1I GRCGYC 1 cut(s) 34
Hin1II CATG 2 cut(s) 129, 145
Hin6I GCGC 1 cut(s) 34
HinP1I GCGC 1 cut(s) 34
HpaII CCGG 1 cut(s) 31
HphI GGTGA 1 cut(s) 159
Hpy188III TCNNGA 1 cut(s) 218
HpyCH4V TGCA 2 cut(s) 82, 92
HpyF10VI GCNNNNNNNGC 1 cut(s) 98
Hsp92I GRCGYC 1 cut(s) 34
Hsp92II CATG 2 cut(s) 129, 145
HspAI GCGC 1 cut(s) 34
KasI GGCGCC 1 cut(s) 33
Kzo9I GATC 1 cut(s) 271
LmnI GCTCC 2 cut(s) 33, 73
LpnPI CCDG 5 cut(s) 35, 44, 117, 144, 275
LweI GCATC 3 cut(s) 79, 211, 229
MalI GATC 1 cut(s) 273
MboI GATC 1 cut(s) 271
MboII GAAGA 1 cut(s) 266
MluCI AATT 1 cut(s) 158
Mly113I GGCGCC 1 cut(s) 34
MseI TTAA 2 cut(s) 12, 66
MspI CCGG 1 cut(s) 31
MspR9I CCNGG 1 cut(s) 132
MvaI CCWGG 1 cut(s) 132
MwoI GCNNNNNNNGC 1 cut(s) 98
NarI GGCGCC 1 cut(s) 34
NdeII GATC 1 cut(s) 271
NlaIII CATG 2 cut(s) 129, 145
NlaIV GGNNCC 2 cut(s) 35, 139
PflMI CCANNNNNTGG 2 cut(s) 131, 147
PluTI GGCGCC 1 cut(s) 37
Psp6I CCWGG 1 cut(s) 130
PspFI CCCAGC 1 cut(s) 289
PspGI CCWGG 1 cut(s) 130
PspN4I GGNNCC 2 cut(s) 35, 139
SaqAI TTAA 2 cut(s) 12, 66
Sau3AI GATC 1 cut(s) 271
ScrFI CCNGG 1 cut(s) 132
SetI ASST 4 cut(s) 78, 172, 189, 236
SfaNI GCATC 3 cut(s) 79, 211, 229
SfoI GGCGCC 1 cut(s) 35
SmlI CTYRAG 1 cut(s) 278
SmoI CTYRAG 1 cut(s) 278
Sse9I AATT 1 cut(s) 158
SspDI GGCGCC 1 cut(s) 33
StyD4I CCNGG 1 cut(s) 130
TaqI TCGA 2 cut(s) 40, 211
TasI AATT 1 cut(s) 158
Tru1I TTAA 2 cut(s) 12, 66
Tru9I TTAA 2 cut(s) 12, 66
TspDTI ATGAA 2 cut(s) 33, 158
Van91I CCANNNNNTGG 2 cut(s) 131, 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.