Rh7DG042400
MYB Family

Myb-related protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
N/A
Physical Location & Seq
Forward (+)
3156213 .. 3185138
28926 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG042400.1

Sequence Viewer

Length: 222 bp
ATGGGAAGACCACCTTGCTGTGACAAAGTTGGAGTGAAAAAAGGGCCATGGACGCCGGAGGAAGACATCATCTTGGTGTCGTACATTCAAGAACACGGCCCTGGGAATTGGAGATCAGTTCCTACCAACACAGGTGCTACACAGCACTGTGGCACAGGCCACAGGCTGCTCAAAGCAGAAATTACTAGCCCTAGTTTTCTCAGAGAAAGTCCATGGTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-binding

Protein Analysis

73

Amino Acids

8.04

Weight (kDa)

7.77

Isoelectric Point (pI)

39.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-binding PF00249 14 - 44 6.1e-10 Myb-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcyI GRCGYC 1 cut(s) 53
AfaI GTAC 1 cut(s) 83
AgsI TTSAA 1 cut(s) 89
AjnI CCWGG 1 cut(s) 100
AoxI GGCC 3 cut(s) 44, 97, 157
ApeKI GCWGC 1 cut(s) 166
AspS9I GGNCC 2 cut(s) 44, 98
BbsI GAAGAC 2 cut(s) 13, 69
BbvI GCAGC 1 cut(s) 153
BceAI ACGGC 1 cut(s) 112
BciT130I CCWGG 1 cut(s) 102
BfaI CTAG 2 cut(s) 186, 192
BisI GCNGC 1 cut(s) 167
BlsI GCNGC 1 cut(s) 168
Bme1390I CCNGG 1 cut(s) 102
BmgT120I GGNCC 2 cut(s) 44, 98
BmrFI CCNGG 1 cut(s) 102
BpiI GAAGAC 2 cut(s) 13, 69
BsaHI GRCGYC 1 cut(s) 53
BsaJI CCNNGG 4 cut(s) 47, 100, 101, 212
BseBI CCWGG 1 cut(s) 102
BseDI CCNNGG 4 cut(s) 47, 100, 101, 212
BseMII CTCAG 1 cut(s) 214
BseXI GCAGC 1 cut(s) 153
BshFI GGCC 3 cut(s) 46, 99, 159
BsiSI CCGG 1 cut(s) 56
BsnI GGCC 3 cut(s) 46, 99, 159
Bsp143I GATC 1 cut(s) 113
Bsp19I CCATGG 2 cut(s) 47, 212
BspANI GGCC 3 cut(s) 46, 99, 159
BspCNI CTCAG 1 cut(s) 213
BssECI CCNNGG 4 cut(s) 47, 100, 101, 212
BssMI GATC 1 cut(s) 113
BssNI GRCGYC 1 cut(s) 53
BssT1I CCWWGG 2 cut(s) 47, 212
Bst2UI CCWGG 1 cut(s) 102
Bst4CI ACNGT 1 cut(s) 149
BstACI GRCGYC 1 cut(s) 53
BstDEI CTNAG 1 cut(s) 200
BstDSI CCRYGG 2 cut(s) 47, 212
BstKTI GATC 1 cut(s) 116
BstMBI GATC 1 cut(s) 113
BstMWI GCNNNNNNNGC 1 cut(s) 52
BstNI CCWGG 1 cut(s) 102
BstSCI CCNGG 1 cut(s) 100
BstV1I GCAGC 1 cut(s) 153
BstV2I GAAGAC 2 cut(s) 13, 69
BsuRI GGCC 3 cut(s) 46, 99, 159
BtgI CCRYGG 2 cut(s) 47, 212
BtsIMutI CAGTG 1 cut(s) 145
Cfr13I GGNCC 2 cut(s) 44, 98
CseI GACGC 1 cut(s) 61
Csp6I GTAC 1 cut(s) 82
CviAII CATG 2 cut(s) 48, 213
CviJI RGCY 5 cut(s) 46, 99, 159, 166, 189
CviKI_1 RGCY 5 cut(s) 46, 99, 159, 166, 189
CviQI GTAC 1 cut(s) 82
DdeI CTNAG 1 cut(s) 200
DpnI GATC 1 cut(s) 115
DpnII GATC 1 cut(s) 113
Eco130I CCWWGG 2 cut(s) 47, 212
EcoRII CCWGG 1 cut(s) 100
EcoT14I CCWWGG 2 cut(s) 47, 212
ErhI CCWWGG 2 cut(s) 47, 212
FaeI CATG 2 cut(s) 51, 216
FaiI YATR 3 cut(s) 49, 214, 220
FalI AAGNNNNNCTT 1 cut(s) 30
FatI CATG 2 cut(s) 47, 212
Fnu4HI GCNGC 1 cut(s) 167
Fsp4HI GCNGC 1 cut(s) 167
FspBI CTAG 2 cut(s) 186, 192
GluI GCNGC 1 cut(s) 167
HaeIII GGCC 3 cut(s) 46, 99, 159
HapII CCGG 1 cut(s) 56
HgaI GACGC 1 cut(s) 61
Hin1I GRCGYC 1 cut(s) 53
Hin1II CATG 2 cut(s) 51, 216
HpaII CCGG 1 cut(s) 56
Hpy188I TCNGA 1 cut(s) 203
Hpy188III TCNNGA 1 cut(s) 89
HpyCH4III ACNGT 1 cut(s) 149
HpyF10VI GCNNNNNNNGC 1 cut(s) 52
HpyF3I CTNAG 1 cut(s) 200
Hsp92I GRCGYC 1 cut(s) 53
Hsp92II CATG 2 cut(s) 51, 216
Kzo9I GATC 1 cut(s) 113
LpnPI CCDG 6 cut(s) 69, 87, 114, 117, 141, 148
Lsp1109I GCAGC 1 cut(s) 153
MaeI CTAG 2 cut(s) 186, 192
MaeIII GTNAC 1 cut(s) 20
MalI GATC 1 cut(s) 115
MboI GATC 1 cut(s) 113
MboII GAAGA 2 cut(s) 18, 74
MluCI AATT 2 cut(s) 106, 180
MmeI TCCRAC 1 cut(s) 10
MnlI CCTC 1 cut(s) 52
MslI CAYNNNNRTG 1 cut(s) 74
MspI CCGG 1 cut(s) 56
MspR9I CCNGG 1 cut(s) 102
MvaI CCWGG 1 cut(s) 102
MwoI GCNNNNNNNGC 1 cut(s) 52
NcoI CCATGG 2 cut(s) 47, 212
NdeII GATC 1 cut(s) 113
NlaIII CATG 2 cut(s) 51, 216
NmuCI GTSAC 1 cut(s) 20
PasI CCCWGGG 1 cut(s) 101
PkrI GCNGC 1 cut(s) 168
Psp6I CCWGG 1 cut(s) 100
PspGI CCWGG 1 cut(s) 100
PspPI GGNCC 2 cut(s) 44, 98
RsaI GTAC 1 cut(s) 83
RsaNI GTAC 1 cut(s) 82
RseI CAYNNNNRTG 1 cut(s) 74
SatI GCNGC 1 cut(s) 167
Sau3AI GATC 1 cut(s) 113
Sau96I GGNCC 2 cut(s) 44, 98
ScrFI CCNGG 1 cut(s) 102
SetI ASST 2 cut(s) 16, 136
SmiMI CAYNNNNRTG 1 cut(s) 74
Sse9I AATT 2 cut(s) 106, 180
SspMI CTAG 2 cut(s) 186, 192
StyD4I CCNGG 1 cut(s) 100
StyI CCWWGG 2 cut(s) 47, 212
TaaI ACNGT 1 cut(s) 149
TasI AATT 2 cut(s) 106, 180
TscAI CASTG 1 cut(s) 152
TseFI GTSAC 1 cut(s) 20
TseI GCWGC 1 cut(s) 166
Tsp45I GTSAC 1 cut(s) 20
TspRI CASTG 1 cut(s) 152
XspI CTAG 2 cut(s) 186, 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.