Rh7DG018100
MYB Family

Myb-related protein 308-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
N/A
Physical Location & Seq
Reverse (-)
1458743 .. 1460677
1935 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG018100.1

Sequence Viewer

Length: 582 bp
ATGAGGAAACCTTGCTGTGAGAAGAAGACGACCAATAAAGGAGCATGGTCGAAGCAAGAAGATGAGAAGCTCACTAAATACATTCAAAAACATGGCGAAGGAAGCTGGCGCTCTCTTCCGGTCGCTGCAGCGAATTCCCAAGCAAATAACGATGATGAAGACGATTCGCAGGATCCATTGTTGGATTCCACAAGTTCCGGCCCCGAAAGCAACACAAGTTGTACTTTGCCTGACTTGAATCTTGATCTCACAATAGGCCTTCCATGGTCACTGGAATTGATTTCCAAACTGTTCGAGGCTCTGAGTTTAATTGTGGACCTACCTATGGCAAAATCTGGCCTTGAATGGATAACACATTGGCCAAATAAAGAAGAGAAACTTCTGGATAACATTTGTAGCAAGCAGCAGAGAATTTCTATTTTGTTTTTCATGAAAAGGATTGGAGCAAGTAATGAACAGAAGATATTACATAGTTTATTCATGAAAACCAAAGCTTTGCTGCTATTTTCTATTGCAAGTGGAACTTCAGATAAGGCAGAAGTGCGATTAATGTGGCCAAGAATATCCCACTTTCGGAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-binding

Protein Analysis

193

Amino Acids

21.79

Weight (kDa)

6.9

Isoelectric Point (pI)

37.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-binding PF00249 13 - 39 5.6e-07 Myb-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 167, 180
AcoI YGGCCR 2 cut(s) 359, 554
AcsI RAATTY 2 cut(s) 133, 411
AcuI CTGAAG 1 cut(s) 510
AfaI GTAC 1 cut(s) 223
AfiI CCNNNNNNNGG 2 cut(s) 325, 573
AgsI TTSAA 3 cut(s) 86, 238, 344
AluBI AGCT 3 cut(s) 70, 105, 494
AluI AGCT 3 cut(s) 70, 105, 494
AlwI GGATC 2 cut(s) 167, 180
AoxI GGCC 5 cut(s) 199, 256, 337, 359, 554
ApeKI GCWGC 4 cut(s) 125, 128, 403, 499
ApoI RAATTY 2 cut(s) 133, 411
AseI ATTAAT 1 cut(s) 548
AspLEI GCGC 1 cut(s) 111
AspS9I GGNCC 2 cut(s) 200, 316
AvaII GGWCC 1 cut(s) 316
BalI TGGCCA 2 cut(s) 361, 556
BamHI GGATCC 1 cut(s) 172
BbsI GAAGAC 2 cut(s) 32, 165
BbvI GCAGC 4 cut(s) 112, 140, 415, 486
BfmI CTRYAG 1 cut(s) 126
BfoI RGCGCY 1 cut(s) 112
BisI GCNGC 4 cut(s) 126, 129, 404, 500
BlsI GCNGC 4 cut(s) 127, 130, 405, 501
Bme18I GGWCC 1 cut(s) 316
BmgT120I GGNCC 2 cut(s) 200, 316
BmiI GGNNCC 2 cut(s) 174, 202
BpiI GAAGAC 2 cut(s) 32, 165
BsaJI CCNNGG 1 cut(s) 263
BsaWI WCCGGW 1 cut(s) 118
Bsc4I CCNNNNNNNGG 2 cut(s) 325, 573
Bse1I ACTGG 1 cut(s) 276
BseDI CCNNGG 1 cut(s) 263
BseLI CCNNNNNNNGG 2 cut(s) 325, 573
BseMII CTCAG 1 cut(s) 293
BseNI ACTGG 1 cut(s) 276
BseXI GCAGC 4 cut(s) 112, 140, 415, 486
Bsh1285I CGRYCG 1 cut(s) 123
BshFI GGCC 5 cut(s) 201, 258, 339, 361, 556
BsiEI CGRYCG 1 cut(s) 123
BsiSI CCGG 2 cut(s) 119, 198
BslI CCNNNNNNNGG 2 cut(s) 325, 573
BsnI GGCC 5 cut(s) 201, 258, 339, 361, 556
Bsp143I GATC 2 cut(s) 172, 244
Bsp19I CCATGG 1 cut(s) 263
BspANI GGCC 5 cut(s) 201, 258, 339, 361, 556
BspCNI CTCAG 1 cut(s) 294
BspHI TCATGA 2 cut(s) 429, 480
BspLI GGNNCC 2 cut(s) 174, 202
BspMAI CTGCAG 1 cut(s) 130
BspPI GGATC 2 cut(s) 167, 180
BsrI ACTGG 1 cut(s) 276
BssECI CCNNGG 1 cut(s) 263
BssMI GATC 2 cut(s) 172, 244
BssT1I CCWWGG 1 cut(s) 263
Bst4CI ACNGT 1 cut(s) 291
Bst6I CTCTTC 2 cut(s) 120, 366
BstC8I GCNNGC 2 cut(s) 107, 401
BstDEI CTNAG 1 cut(s) 302
BstDSI CCRYGG 1 cut(s) 263
BstH2I RGCGCY 1 cut(s) 112
BstHHI GCGC 1 cut(s) 111
BstKTI GATC 2 cut(s) 175, 247
BstMBI GATC 2 cut(s) 172, 244
BstMCI CGRYCG 1 cut(s) 123
BstMWI GCNNNNNNNGC 2 cut(s) 102, 207
BstSFI CTRYAG 1 cut(s) 126
BstV1I GCAGC 4 cut(s) 112, 140, 415, 486
BstV2I GAAGAC 2 cut(s) 32, 165
BstX2I RGATCY 1 cut(s) 172
BstYI RGATCY 1 cut(s) 172
BsuRI GGCC 5 cut(s) 201, 258, 339, 361, 556
BtgI CCRYGG 1 cut(s) 263
BtsIMutI CAGTG 1 cut(s) 269
Cac8I GCNNGC 2 cut(s) 107, 401
CciI TCATGA 2 cut(s) 429, 480
CfoI GCGC 1 cut(s) 111
Cfr13I GGNCC 2 cut(s) 200, 316
Csp6I GTAC 1 cut(s) 222
CviAII CATG 5 cut(s) 45, 92, 264, 430, 481
CviJI RGCY 9 cut(s) 70, 105, 201, 258, 299, 339, 361, 494, 556
CviKI_1 RGCY 9 cut(s) 70, 105, 201, 258, 299, 339, 361, 494, 556
CviQI GTAC 1 cut(s) 222
DdeI CTNAG 1 cut(s) 302
DpnI GATC 2 cut(s) 174, 246
DpnII GATC 2 cut(s) 172, 244
EaeI YGGCCR 2 cut(s) 359, 554
Eam1104I CTCTTC 2 cut(s) 120, 366
EarI CTCTTC 2 cut(s) 120, 366
Eco130I CCWWGG 1 cut(s) 263
Eco147I AGGCCT 1 cut(s) 258
Eco47I GGWCC 1 cut(s) 316
Eco57I CTGAAG 1 cut(s) 510
EcoRI GAATTC 1 cut(s) 133
EcoT14I CCWWGG 1 cut(s) 263
ErhI CCWWGG 1 cut(s) 263
FaeI CATG 5 cut(s) 48, 95, 267, 433, 484
FaiI YATR 7 cut(s) 46, 93, 265, 326, 431, 471, 482
FalI AAGNNNNNCTT 6 cut(s) 208, 240, 363, 395, 508, 540
FatI CATG 5 cut(s) 44, 91, 263, 429, 480
Fnu4HI GCNGC 4 cut(s) 126, 129, 404, 500
Fsp4HI GCNGC 4 cut(s) 126, 129, 404, 500
GlaI GCGC 1 cut(s) 110
GluI GCNGC 4 cut(s) 126, 129, 404, 500
HaeII RGCGCY 1 cut(s) 112
HaeIII GGCC 5 cut(s) 201, 258, 339, 361, 556
HapII CCGG 2 cut(s) 119, 198
HhaI GCGC 1 cut(s) 111
Hin1II CATG 5 cut(s) 48, 95, 267, 433, 484
Hin6I GCGC 1 cut(s) 109
HinP1I GCGC 1 cut(s) 109
HindIII AAGCTT 1 cut(s) 492
HinfI GANTC 3 cut(s) 164, 185, 238
HpaII CCGG 2 cut(s) 119, 198
Hpy166II GTNNAC 1 cut(s) 316
Hpy188I TCNGA 3 cut(s) 303, 529, 576
Hpy188III TCNNGA 4 cut(s) 242, 383, 430, 481
Hpy8I GTNNAC 1 cut(s) 316
HpyAV CCTTC 2 cut(s) 92, 269
HpyCH4III ACNGT 1 cut(s) 291
HpyCH4V TGCA 2 cut(s) 128, 515
HpyF10VI GCNNNNNNNGC 2 cut(s) 102, 207
HpyF3I CTNAG 1 cut(s) 302
Hsp92II CATG 5 cut(s) 48, 95, 267, 433, 484
HspAI GCGC 1 cut(s) 109
Kzo9I GATC 2 cut(s) 172, 244
LmnI GCTCC 2 cut(s) 41, 443
LpnPI CCDG 8 cut(s) 91, 132, 155, 211, 243, 257, 321, 368
Lsp1109I GCAGC 4 cut(s) 112, 140, 415, 486
MaeIII GTNAC 1 cut(s) 267
MalI GATC 2 cut(s) 174, 246
MboI GATC 2 cut(s) 172, 244
MboII GAAGA 7 cut(s) 34, 37, 71, 107, 170, 383, 472
MflI RGATCY 1 cut(s) 172
MlsI TGGCCA 2 cut(s) 361, 556
MluCI AATT 4 cut(s) 133, 275, 309, 411
MluNI TGGCCA 2 cut(s) 361, 556
MmeI TCCRAC 1 cut(s) 162
MnlI CCTC 1 cut(s) 289
Mox20I TGGCCA 2 cut(s) 361, 556
MscI TGGCCA 2 cut(s) 361, 556
MseI TTAA 2 cut(s) 308, 548
Msp20I TGGCCA 2 cut(s) 361, 556
MspI CCGG 2 cut(s) 119, 198
MwoI GCNNNNNNNGC 2 cut(s) 102, 207
NcoI CCATGG 1 cut(s) 263
NdeII GATC 2 cut(s) 172, 244
NlaIII CATG 5 cut(s) 48, 95, 267, 433, 484
NlaIV GGNNCC 2 cut(s) 174, 202
NmuCI GTSAC 1 cut(s) 267
PagI TCATGA 2 cut(s) 429, 480
PceI AGGCCT 1 cut(s) 258
PfeI GAWTC 3 cut(s) 164, 185, 238
PkrI GCNGC 4 cut(s) 127, 130, 405, 501
PshBI ATTAAT 1 cut(s) 548
PspN4I GGNNCC 2 cut(s) 174, 202
PspPI GGNCC 2 cut(s) 200, 316
PstI CTGCAG 1 cut(s) 130
PsuI RGATCY 1 cut(s) 172
RsaI GTAC 1 cut(s) 223
RsaNI GTAC 1 cut(s) 222
SaqAI TTAA 2 cut(s) 308, 548
SatI GCNGC 4 cut(s) 126, 129, 404, 500
Sau3AI GATC 2 cut(s) 172, 244
Sau96I GGNCC 2 cut(s) 200, 316
SetI ASST 6 cut(s) 13, 72, 107, 321, 325, 496
SfcI CTRYAG 1 cut(s) 126
SinI GGWCC 1 cut(s) 316
Sse9I AATT 4 cut(s) 133, 275, 309, 411
SseBI AGGCCT 1 cut(s) 258
StuI AGGCCT 1 cut(s) 258
StyI CCWWGG 1 cut(s) 263
TaaI ACNGT 1 cut(s) 291
TaqI TCGA 2 cut(s) 50, 294
TasI AATT 4 cut(s) 133, 275, 309, 411
TatI WGTACW 1 cut(s) 221
TfiI GAWTC 3 cut(s) 164, 185, 238
Tru1I TTAA 2 cut(s) 308, 548
Tru9I TTAA 2 cut(s) 308, 548
TscAI CASTG 1 cut(s) 276
TseFI GTSAC 1 cut(s) 267
TseI GCWGC 4 cut(s) 125, 128, 403, 499
Tsp45I GTSAC 1 cut(s) 267
TspDTI ATGAA 6 cut(s) 171, 418, 446, 468, 469, 497
TspRI CASTG 1 cut(s) 276
VpaK11BI GGWCC 1 cut(s) 316
VspI ATTAAT 1 cut(s) 548
XapI RAATTY 2 cut(s) 133, 411
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.