Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr7B

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Forward (+)

9012170 .. 9013985

Gene Structure 1816 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh7BG121100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 192 bp

ATGGACACGGAACAGGGTGATCAAACCAGAGTCATTCTGGGTTTTAAATATAAGACAGCCAGATACAAACCAGAGTCATCAGAAGGAACTTGTGAGAAGAATCTGACTCCTGTTGAAGAAATGATTTCTACATACTTGAAAACGCAGATGGATGAAAAGGTTTATAAAGTTGAGGTGATTGCTCTTGAGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003700 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006355 GO:0008150 GO:0009888 GO:0009889 GO:0009891 GO:0009893 GO:0010087 GO:0010088 GO:0010089 GO:0010468 GO:0010556 GO:0010557 GO:0010604 GO:0010628 GO:0019219 GO:0019222 GO:0031323 GO:0031325 GO:0031326 GO:0031328 GO:0032502 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0045893 GO:0045935 GO:0048518 GO:0048522 GO:0048856 GO:0050789 GO:0050794 GO:0051171 GO:0051173 GO:0051252 GO:0051254 GO:0060255 GO:0065007 GO:0080090 GO:0140110 GO:1902680 GO:1903506 GO:1903508 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Myb_CC_LHEQLE Myb_DNA-binding

Protein Analysis

63

Amino Acids

7.29

Weight (kDa)

4.93

Isoelectric Point (pI)

24.23

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	165
AgsI	TTSAA	2 cut(s)	116, 139
AsuHPI	GGTGA	2 cut(s)	29, 187
BccI	CCATC	1 cut(s)	142
BclI	TGATCA	1 cut(s)	19
BseGI	GGATG	1 cut(s)	157
Bsp143I	GATC	1 cut(s)	19
BssMI	GATC	1 cut(s)	19
BstF5I	GGATG	1 cut(s)	157
BstKTI	GATC	1 cut(s)	22
BstMBI	GATC	1 cut(s)	19
BtsCI	GGATG	1 cut(s)	157
CviJI	RGCY	1 cut(s)	59
CviKI_1	RGCY	1 cut(s)	59
DpnI	GATC	1 cut(s)	21
DpnII	GATC	1 cut(s)	19
DraI	TTTAAA	1 cut(s)	46
FaiI	YATR	3 cut(s)	51, 133, 165
FbaI	TGATCA	1 cut(s)	19
FokI	GGATG	1 cut(s)	164
HinfI	GANTC	4 cut(s)	30, 74, 100, 106
HphI	GGTGA	2 cut(s)	29, 187
Hpy188I	TCNGA	2 cut(s)	82, 105
Hpy188III	TCNNGA	1 cut(s)	185
HpyAV	CCTTC	1 cut(s)	77
Ksp22I	TGATCA	1 cut(s)	19
Kzo9I	GATC	1 cut(s)	19
LpnPI	CCDG	5 cut(s)	23, 40, 73, 84, 123
MalI	GATC	1 cut(s)	21
MboI	GATC	1 cut(s)	19
MboII	GAAGA	2 cut(s)	109, 128
MlyI	GAGTC	3 cut(s)	39, 83, 100
MnlI	CCTC	1 cut(s)	166
MseI	TTAA	1 cut(s)	45
NdeII	GATC	1 cut(s)	19
PfeI	GAWTC	1 cut(s)	100
PleI	GAGTC	3 cut(s)	38, 82, 100
PpsI	GAGTC	3 cut(s)	38, 82, 100
PsiI	TTATAA	1 cut(s)	165
SaqAI	TTAA	1 cut(s)	45
Sau3AI	GATC	1 cut(s)	19
SchI	GAGTC	3 cut(s)	39, 83, 100
SetI	ASST	2 cut(s)	162, 177
SgeI	CNNG	9 cut(s)	19, 26, 39, 50, 72, 83, 102, 122, 148
SmlI	CTYRAG	1 cut(s)	185
SmoI	CTYRAG	1 cut(s)	185
TfiI	GAWTC	1 cut(s)	100
Tru1I	TTAA	1 cut(s)	45
Tru9I	TTAA	1 cut(s)	45
TspDTI	ATGAA	1 cut(s)	168
TspGWI	ACGGA	1 cut(s)	23
XcmI	CCANNNNNNNNNTGG	1 cut(s)	34

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.