Rmu_sc0021216.1_g000001
MYB Family

Myb-related protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021216.1
N/A
Physical Location & Seq
Forward (+)
1 .. 413
413 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021216.1_g000001.1.cds

Sequence Viewer

Length: 223 bp
ggaaagacggaaagaccatggcattgtggactcggataagaatcttgcaccaccaaatcagctggggagtagttccctttccgcgccaaatgttgtggtggagcgtcgcaccctcgactttagcgagtgtgaaacacctgggaaggggaaagaaagcggaaaattcttgaatgctaaaagcttctcaagtccatctagctatttgttgaagggatgcagataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0000981 GO:0000988 GO:0000989 GO:0001067 GO:0001076 GO:0001101 GO:0001134 GO:0001135 GO:0003674 GO:0003676 GO:0003677 GO:0003700 GO:0003712 GO:0003713 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006275 GO:0006355 GO:0006357 GO:0008150 GO:0008285 GO:0009605 GO:0009607 GO:0009608 GO:0009610 GO:0009620 GO:0009623 GO:0009719 GO:0009725 GO:0009751 GO:0009889 GO:0009890 GO:0009891 GO:0009892 GO:0009893 GO:0009987 GO:0010033 GO:0010468 GO:0010556 GO:0010557 GO:0010558 GO:0010564 GO:0010604 GO:0010605 GO:0010628 GO:0010629 GO:0014070 GO:0019219 GO:0019222 GO:0030154 GO:0031323 GO:0031324 GO:0031325 GO:0031326 GO:0031327 GO:0031328 GO:0032465 GO:0032502 GO:0032875 GO:0042127 GO:0042221 GO:0042493 GO:0043207 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043565 GO:0044212 GO:0044424 GO:0044464 GO:0045892 GO:0045893 GO:0045934 GO:0045935 GO:0046677 GO:0048518 GO:0048519 GO:0048522 GO:0048523 GO:0048583 GO:0048585 GO:0048869 GO:0050789 GO:0050794 GO:0050896 GO:0051052 GO:0051171 GO:0051172 GO:0051173 GO:0051252 GO:0051253 GO:0051254 GO:0051302 GO:0051704 GO:0051707 GO:0051726 GO:0060255 GO:0065007 GO:0080090 GO:0090329 GO:0097159 GO:0140110 GO:1901181 GO:1901363 GO:1901700 GO:1902679 GO:1902680 GO:1903506 GO:1903507 GO:1903508 GO:2000112 GO:2000113 GO:2001023 GO:2001024 GO:2001038 GO:2001039 GO:2001141
KEGG Pathways
Metabolic & Signaling
ko04151 ko04218 ko05166 map04151 map04218 map05166
Pfam Domains
Protein Families
Myb_DNA-binding

Protein Analysis

73

Amino Acids

7.92

Weight (kDa)

9.11

Isoelectric Point (pI)

50.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 84
AciI CCGC 2 cut(s) 82, 157
AcsI RAATTY 1 cut(s) 162
AfiI CCNNNNNNNGG 1 cut(s) 144
AgsI TTSAA 2 cut(s) 170, 209
AjnI CCWGG 1 cut(s) 137
AluBI AGCT 3 cut(s) 62, 181, 199
AluI AGCT 3 cut(s) 62, 181, 199
ApoI RAATTY 1 cut(s) 162
AspLEI GCGC 1 cut(s) 86
BccI CCATC 1 cut(s) 200
BciT130I CCWGG 1 cut(s) 139
BfaI CTAG 1 cut(s) 196
Bme1390I CCNGG 1 cut(s) 139
BmrFI CCNGG 1 cut(s) 139
BmsI GCATC 1 cut(s) 204
BpuEI CTTGAG 1 cut(s) 170
BsaBI GATNNNNATC 1 cut(s) 40
BsaJI CCNNGG 2 cut(s) 17, 138
Bsc4I CCNNNNNNNGG 1 cut(s) 144
Bse8I GATNNNNATC 1 cut(s) 40
BseBI CCWGG 1 cut(s) 139
BseDI CCNNGG 2 cut(s) 17, 138
BseGI GGATG 1 cut(s) 219
BseJI GATNNNNATC 1 cut(s) 40
BseLI CCNNNNNNNGG 1 cut(s) 144
BseYI CCCAGC 1 cut(s) 62
Bsh1236I CGCG 1 cut(s) 84
BslI CCNNNNNNNGG 1 cut(s) 144
BsmI GAATGC 1 cut(s) 176
Bsp19I CCATGG 1 cut(s) 17
BspACI CCGC 2 cut(s) 82, 157
BspFNI CGCG 1 cut(s) 84
BssECI CCNNGG 2 cut(s) 17, 138
BssT1I CCWWGG 1 cut(s) 17
Bst2UI CCWGG 1 cut(s) 139
BstDSI CCRYGG 1 cut(s) 17
BstF5I GGATG 1 cut(s) 219
BstFNI CGCG 1 cut(s) 84
BstHHI GCGC 1 cut(s) 86
BstNI CCWGG 1 cut(s) 139
BstSCI CCNGG 1 cut(s) 137
BstUI CGCG 1 cut(s) 84
BtgI CCRYGG 1 cut(s) 17
BtsCI GGATG 1 cut(s) 219
CfoI GCGC 1 cut(s) 86
CseI GACGC 1 cut(s) 93
CspCI CAANNNNNGTGG 2 cut(s) 76, 111
CviAII CATG 1 cut(s) 18
CviJI RGCY 3 cut(s) 62, 181, 199
CviKI_1 RGCY 3 cut(s) 62, 181, 199
Eco130I CCWWGG 1 cut(s) 17
EcoRII CCWGG 1 cut(s) 137
EcoT14I CCWWGG 1 cut(s) 17
ErhI CCWWGG 1 cut(s) 17
FaeI CATG 1 cut(s) 21
FaiI YATR 1 cut(s) 19
FatI CATG 1 cut(s) 17
FspBI CTAG 1 cut(s) 196
GlaI GCGC 1 cut(s) 85
GsaI CCCAGC 1 cut(s) 66
HgaI GACGC 1 cut(s) 93
HhaI GCGC 1 cut(s) 86
Hin1II CATG 1 cut(s) 21
Hin6I GCGC 1 cut(s) 84
HinP1I GCGC 1 cut(s) 84
HindIII AAGCTT 1 cut(s) 179
HinfI GANTC 2 cut(s) 30, 41
Hpy166II GTNNAC 1 cut(s) 29
Hpy188I TCNGA 1 cut(s) 35
Hpy188III TCNNGA 1 cut(s) 167
Hpy8I GTNNAC 1 cut(s) 29
Hpy99I CGWCG 1 cut(s) 109
HpyAV CCTTC 2 cut(s) 137, 203
HpyCH4V TGCA 2 cut(s) 48, 217
Hsp92II CATG 1 cut(s) 21
HspAI GCGC 1 cut(s) 84
LmnI GCTCC 1 cut(s) 101
LpnPI CCDG 3 cut(s) 48, 124, 151
LweI GCATC 1 cut(s) 204
MaeI CTAG 1 cut(s) 196
MluCI AATT 1 cut(s) 162
MlyI GAGTC 1 cut(s) 24
MnlI CCTC 1 cut(s) 123
MspA1I CMGCKG 1 cut(s) 62
MspR9I CCNGG 1 cut(s) 139
Mva1269I GAATGC 1 cut(s) 176
MvaI CCWGG 1 cut(s) 139
MvnI CGCG 1 cut(s) 84
NcoI CCATGG 1 cut(s) 17
NlaIII CATG 1 cut(s) 21
PcsI WCGNNNNNNNCGW 1 cut(s) 121
PctI GAATGC 1 cut(s) 176
PfeI GAWTC 1 cut(s) 41
PleI GAGTC 1 cut(s) 24
PpsI GAGTC 1 cut(s) 24
Psp6I CCWGG 1 cut(s) 137
PspFI CCCAGC 1 cut(s) 62
PspGI CCWGG 1 cut(s) 137
PvuII CAGCTG 1 cut(s) 62
SchI GAGTC 1 cut(s) 24
ScrFI CCNGG 1 cut(s) 139
SetI ASST 4 cut(s) 64, 140, 183, 201
SfaNI GCATC 1 cut(s) 204
SmlI CTYRAG 1 cut(s) 185
SmoI CTYRAG 1 cut(s) 185
Sse9I AATT 1 cut(s) 162
SsiI CCGC 2 cut(s) 82, 157
SspMI CTAG 1 cut(s) 196
StyD4I CCNGG 1 cut(s) 137
StyI CCWWGG 1 cut(s) 17
TaqI TCGA 1 cut(s) 115
TasI AATT 1 cut(s) 162
TfiI GAWTC 1 cut(s) 41
TspGWI ACGGA 1 cut(s) 23
XapI RAATTY 1 cut(s) 162
XspI CTAG 1 cut(s) 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.