Rmu_sc0000105.1_g000016
MYB Family

Myb-related protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000105.1
N/A
Physical Location & Seq
Forward (+)
62071 .. 62316
246 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000105.1_g000016.1.cds

Sequence Viewer

Length: 246 bp
atgagtaacctaaacaaattggactttgctccattaggagcaactcagtctggatatcacaggtgggttcgtgatgtccgccagcatctcaagtccgatggaattctggatatgattattgagcctagccaggatgtgctaactgttgagcaagctcaagctttggaagcaaatagagctgccttagaggaaaataaggaaaaagccatcatcctattgactcgtcatatggatgattcgctctag

Protein Analysis

81

Amino Acids

9.17

Weight (kDa)

5.19

Isoelectric Point (pI)

62.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 79
AcsI RAATTY 1 cut(s) 102
AjnI CCWGG 1 cut(s) 129
AluBI AGCT 3 cut(s) 155, 161, 179
AluI AGCT 3 cut(s) 155, 161, 179
ApeKI GCWGC 1 cut(s) 179
ApoI RAATTY 1 cut(s) 102
BbvI GCAGC 1 cut(s) 166
BccI CCATC 2 cut(s) 92, 215
BciT130I CCWGG 1 cut(s) 131
BfaI CTAG 2 cut(s) 126, 244
BisI GCNGC 1 cut(s) 180
BlsI GCNGC 1 cut(s) 181
Bme1390I CCNGG 1 cut(s) 131
BmrFI CCNGG 1 cut(s) 131
BmsI GCATC 1 cut(s) 94
BpuEI CTTGAG 2 cut(s) 74, 141
BseBI CCWGG 1 cut(s) 131
BseGI GGATG 3 cut(s) 139, 210, 238
BseMII CTCAG 1 cut(s) 59
BseXI GCAGC 1 cut(s) 166
BspACI CCGC 1 cut(s) 79
BspCNI CTCAG 1 cut(s) 58
Bst2UI CCWGG 1 cut(s) 131
Bst4CI ACNGT 1 cut(s) 145
BstC8I GCNNGC 2 cut(s) 83, 153
BstDEI CTNAG 2 cut(s) 45, 184
BstF5I GGATG 3 cut(s) 139, 210, 238
BstMWI GCNNNNNNNGC 2 cut(s) 167, 176
BstNI CCWGG 1 cut(s) 131
BstSCI CCNGG 1 cut(s) 129
BstV1I GCAGC 1 cut(s) 166
BtsCI GGATG 3 cut(s) 139, 210, 238
Cac8I GCNNGC 2 cut(s) 83, 153
CviJI RGCY 6 cut(s) 124, 129, 155, 161, 179, 206
CviKI_1 RGCY 6 cut(s) 124, 129, 155, 161, 179, 206
DdeI CTNAG 2 cut(s) 45, 184
EciI GGCGGA 1 cut(s) 68
Eco32I GATATC 1 cut(s) 56
EcoRI GAATTC 1 cut(s) 102
EcoRII CCWGG 1 cut(s) 129
EcoRV GATATC 1 cut(s) 56
FaiI YATR 3 cut(s) 113, 228, 230
FauNDI CATATG 1 cut(s) 228
Fnu4HI GCNGC 1 cut(s) 180
FokI GGATG 2 cut(s) 146, 197
Fsp4HI GCNGC 1 cut(s) 180
FspBI CTAG 2 cut(s) 126, 244
GluI GCNGC 1 cut(s) 180
HindIII AAGCTT 1 cut(s) 159
HinfI GANTC 2 cut(s) 220, 236
Hpy188I TCNGA 1 cut(s) 97
Hpy188III TCNNGA 3 cut(s) 51, 71, 107
HpyCH4III ACNGT 1 cut(s) 145
HpyF10VI GCNNNNNNNGC 2 cut(s) 167, 176
HpyF3I CTNAG 2 cut(s) 45, 184
LmnI GCTCC 2 cut(s) 34, 38
LpnPI CCDG 6 cut(s) 36, 46, 92, 95, 116, 143
Lsp1109I GCAGC 1 cut(s) 166
LweI GCATC 1 cut(s) 94
MaeI CTAG 2 cut(s) 126, 244
MaeIII GTNAC 1 cut(s) 5
MluCI AATT 2 cut(s) 17, 102
MlyI GAGTC 1 cut(s) 214
MnlI CCTC 1 cut(s) 181
MslI CAYNNNNRTG 1 cut(s) 231
MspR9I CCNGG 1 cut(s) 131
MvaI CCWGG 1 cut(s) 131
MwoI GCNNNNNNNGC 2 cut(s) 167, 176
NdeI CATATG 1 cut(s) 228
PfeI GAWTC 1 cut(s) 236
PkrI GCNGC 1 cut(s) 181
PleI GAGTC 1 cut(s) 214
PpsI GAGTC 1 cut(s) 214
Psp6I CCWGG 1 cut(s) 129
PspGI CCWGG 1 cut(s) 129
RseI CAYNNNNRTG 1 cut(s) 231
SatI GCNGC 1 cut(s) 180
SchI GAGTC 1 cut(s) 214
ScrFI CCNGG 1 cut(s) 131
SetI ASST 5 cut(s) 12, 65, 157, 163, 181
SfaNI GCATC 1 cut(s) 94
SmiMI CAYNNNNRTG 1 cut(s) 231
SmlI CTYRAG 2 cut(s) 89, 156
SmoI CTYRAG 2 cut(s) 89, 156
Sse9I AATT 2 cut(s) 17, 102
SsiI CCGC 1 cut(s) 79
SspMI CTAG 2 cut(s) 126, 244
StyD4I CCNGG 1 cut(s) 129
TaaI ACNGT 1 cut(s) 145
TasI AATT 2 cut(s) 17, 102
TfiI GAWTC 1 cut(s) 236
TseI GCWGC 1 cut(s) 179
XapI RAATTY 1 cut(s) 102
XspI CTAG 2 cut(s) 126, 244
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.