Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8233093.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 543

Gene Structure 543 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8233093.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 209 bp

atgatcaggagcatgactgcacaagaggctgctgctgctgctgcacaagcagttgccgaggcagaagctgccattgcagctgctgaagaggcagcacgggaggcagaggcagcagaagctgaagcagaagcagcacaagtttttgcaaaggcagcagtgaaagcattgaaatgtagaagacttgatcttgatatgaaactcgcacacgg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000228 GO:0000723 GO:0000781 GO:0000784 GO:0000785 GO:0001101 GO:0003674 GO:0003676 GO:0003677 GO:0003690 GO:0003691 GO:0003697 GO:0003700 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005694 GO:0005730 GO:0006139 GO:0006259 GO:0006355 GO:0006725 GO:0006807 GO:0006950 GO:0006970 GO:0006996 GO:0008150 GO:0008152 GO:0009628 GO:0009651 GO:0009719 GO:0009723 GO:0009725 GO:0009733 GO:0009737 GO:0009739 GO:0009751 GO:0009753 GO:0009889 GO:0009987 GO:0010033 GO:0010035 GO:0010038 GO:0010468 GO:0010556 GO:0014070 GO:0016043 GO:0019219 GO:0019222 GO:0031323 GO:0031326 GO:0031627 GO:0031974 GO:0031981 GO:0032200 GO:0033993 GO:0034641 GO:0042162 GO:0042221 GO:0042493 GO:0042592 GO:0042802 GO:0042803 GO:0043047 GO:0043170 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0043565 GO:0044237 GO:0044238 GO:0044260 GO:0044422 GO:0044424 GO:0044427 GO:0044428 GO:0044446 GO:0044454 GO:0044464 GO:0046483 GO:0046677 GO:0046686 GO:0046983 GO:0050789 GO:0050794 GO:0050896 GO:0051171 GO:0051252 GO:0051276 GO:0060249 GO:0060255 GO:0065007 GO:0065008 GO:0070013 GO:0071704 GO:0071840 GO:0080090 GO:0090304 GO:0097159 GO:0097305 GO:0098687 GO:0098847 GO:0140110 GO:1901360 GO:1901363 GO:1901700 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Linker_histone Myb_DNA-binding

Protein Analysis

70

Amino Acids

7.13

Weight (kDa)

4.87

Isoelectric Point (pI)

24.71

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	2 cut(s)	105, 141
AgsI	TTSAA	1 cut(s)	169
AluBI	AGCT	3 cut(s)	68, 80, 119
AluI	AGCT	3 cut(s)	68, 80, 119
AlwNI	CAGNNNCTG	3 cut(s)	68, 83, 119
BbsI	GAAGAC	1 cut(s)	184
BclI	TGATCA	1 cut(s)	3
BpiI	GAAGAC	1 cut(s)	184
BsaJI	CCNNGG	1 cut(s)	57
Bse3DI	GCAATG	1 cut(s)	72
BseDI	CCNNGG	1 cut(s)	57
BseMI	GCAATG	1 cut(s)	72
BsgI	GTGCAG	1 cut(s)	27
Bsp143I	GATC	2 cut(s)	3, 184
BsrDI	GCAATG	1 cut(s)	72
BssECI	CCNNGG	1 cut(s)	57
BssMI	GATC	2 cut(s)	3, 184
Bst6I	CTCTTC	1 cut(s)	81
BstAPI	GCANNNNNTGC	1 cut(s)	68
BstKTI	GATC	2 cut(s)	6, 187
BstMBI	GATC	2 cut(s)	3, 184
BstV2I	GAAGAC	1 cut(s)	184
BtsI	GCAGTG	1 cut(s)	162
BtsIMutI	CAGTG	1 cut(s)	162
CaiI	CAGNNNCTG	3 cut(s)	68, 83, 119
CviAII	CATG	1 cut(s)	13
CviJI	RGCY	4 cut(s)	29, 68, 80, 119
CviKI_1	RGCY	4 cut(s)	29, 68, 80, 119
DpnI	GATC	2 cut(s)	5, 186
DpnII	GATC	2 cut(s)	3, 184
Eam1104I	CTCTTC	1 cut(s)	81
EarI	CTCTTC	1 cut(s)	81
Eco57I	CTGAAG	2 cut(s)	105, 141
FaeI	CATG	1 cut(s)	16
FaiI	YATR	2 cut(s)	14, 194
FatI	CATG	1 cut(s)	12
FbaI	TGATCA	1 cut(s)	3
Hin1II	CATG	1 cut(s)	16
Hpy188III	TCNNGA	2 cut(s)	7, 188
HpyCH4V	TGCA	4 cut(s)	20, 44, 77, 146
Hsp92II	CATG	1 cut(s)	16
Ksp22I	TGATCA	1 cut(s)	3
Kzo9I	GATC	2 cut(s)	3, 184
LmnI	GCTCC	1 cut(s)	9
MalI	GATC	2 cut(s)	5, 186
MboI	GATC	2 cut(s)	3, 184
MboII	GAAGA	2 cut(s)	98, 189
MnlI	CCTC	5 cut(s)	19, 52, 82, 94, 100
MslI	CAYNNNNRTG	1 cut(s)	169
MspA1I	CMGCKG	1 cut(s)	80
NdeII	GATC	2 cut(s)	3, 184
NlaIII	CATG	1 cut(s)	16
NmeAIII	GCCGAG	1 cut(s)	82
PstNI	CAGNNNCTG	3 cut(s)	68, 83, 119
PvuII	CAGCTG	1 cut(s)	80
RseI	CAYNNNNRTG	1 cut(s)	169
Sau3AI	GATC	2 cut(s)	3, 184
SetI	ASST	3 cut(s)	70, 82, 121
SmiMI	CAYNNNNRTG	1 cut(s)	169
TscAI	CASTG	1 cut(s)	162
TspDTI	ATGAA	1 cut(s)	209
TspRI	CASTG	1 cut(s)	162

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.