Rmu_co8140416.1_g000001
MYB Family

TSL-kinase interacting protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8140416.1
N/A
Physical Location & Seq
Forward (+)
1 .. 483
483 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8140416.1_g000001.1.cds

Sequence Viewer

Length: 245 bp
ttaaaaaaccaacacggcaatgggctgcttggacacatcaagaagagcaaagtttttttgctgcactacgacaagttggcaagaattttgagaaaatcacttgtcgtgttcaaagtaaaaacaaggatcaggtcaggcattattactatcgtcttgtgaggcgtatgaacaagctgctgggtccaggattatatttggattccagaaattctaaagatactaatgctgctatgcttagatggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003682 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-binding

Protein Analysis

80

Amino Acids

9.66

Weight (kDa)

10.44

Isoelectric Point (pI)

58.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 134
AcsI RAATTY 2 cut(s) 84, 207
AgsI TTSAA 1 cut(s) 112
AjnI CCWGG 1 cut(s) 183
AluBI AGCT 1 cut(s) 174
AluI AGCT 1 cut(s) 174
AlwI GGATC 1 cut(s) 134
ApeKI GCWGC 4 cut(s) 25, 61, 174, 226
ApoI RAATTY 2 cut(s) 84, 207
AspS9I GGNCC 1 cut(s) 181
AvaII GGWCC 1 cut(s) 181
BbvI GCAGC 4 cut(s) 12, 48, 161, 213
BccI CCATC 1 cut(s) 233
BceAI ACGGC 1 cut(s) 31
BciT130I CCWGG 1 cut(s) 185
BisI GCNGC 4 cut(s) 26, 62, 175, 227
BlsI GCNGC 4 cut(s) 27, 63, 176, 228
Bme1390I CCNGG 1 cut(s) 185
Bme18I GGWCC 1 cut(s) 181
BmgT120I GGNCC 1 cut(s) 181
BmiI GGNNCC 1 cut(s) 182
BmrFI CCNGG 1 cut(s) 185
Bse3DI GCAATG 1 cut(s) 25
BseBI CCWGG 1 cut(s) 185
BseMI GCAATG 1 cut(s) 25
BseXI GCAGC 4 cut(s) 12, 48, 161, 213
BseYI CCCAGC 1 cut(s) 177
BsgI GTGCAG 1 cut(s) 47
Bsp143I GATC 1 cut(s) 126
BspLI GGNNCC 1 cut(s) 182
BspPI GGATC 1 cut(s) 134
BspQI GCTCTTC 1 cut(s) 38
BsrDI GCAATG 1 cut(s) 25
BssMI GATC 1 cut(s) 126
Bst2UI CCWGG 1 cut(s) 185
Bst6I CTCTTC 1 cut(s) 38
BstDEI CTNAG 1 cut(s) 235
BstKTI GATC 1 cut(s) 129
BstMBI GATC 1 cut(s) 126
BstNI CCWGG 1 cut(s) 185
BstSCI CCNGG 1 cut(s) 183
BstV1I GCAGC 4 cut(s) 12, 48, 161, 213
Cfr13I GGNCC 1 cut(s) 181
CviJI RGCY 2 cut(s) 25, 174
CviKI_1 RGCY 2 cut(s) 25, 174
DdeI CTNAG 1 cut(s) 235
DpnI GATC 1 cut(s) 128
DpnII GATC 1 cut(s) 126
Eam1104I CTCTTC 1 cut(s) 38
EarI CTCTTC 1 cut(s) 38
Eco47I GGWCC 1 cut(s) 181
EcoRII CCWGG 1 cut(s) 183
FaiI YATR 3 cut(s) 166, 192, 232
Fnu4HI GCNGC 4 cut(s) 26, 62, 175, 227
Fsp4HI GCNGC 4 cut(s) 26, 62, 175, 227
GluI GCNGC 4 cut(s) 26, 62, 175, 227
GsaI CCCAGC 1 cut(s) 181
HinfI GANTC 1 cut(s) 199
Hpy188III TCNNGA 2 cut(s) 40, 203
HpyCH4V TGCA 1 cut(s) 64
HpyF3I CTNAG 1 cut(s) 235
Kzo9I GATC 1 cut(s) 126
LguI GCTCTTC 1 cut(s) 38
LpnPI CCDG 6 cut(s) 115, 120, 163, 170, 197, 216
Lsp1109I GCAGC 4 cut(s) 12, 48, 161, 213
MalI GATC 1 cut(s) 128
MboI GATC 1 cut(s) 126
MboII GAAGA 1 cut(s) 55
MluCI AATT 2 cut(s) 84, 207
MnlI CCTC 1 cut(s) 152
MseI TTAA 1 cut(s) 2
MslI CAYNNNNRTG 1 cut(s) 18
MspR9I CCNGG 1 cut(s) 185
MvaI CCWGG 1 cut(s) 185
NdeII GATC 1 cut(s) 126
NlaIV GGNNCC 1 cut(s) 182
PciSI GCTCTTC 1 cut(s) 38
PfeI GAWTC 1 cut(s) 199
PfoI TCCNGGA 1 cut(s) 183
PkrI GCNGC 4 cut(s) 27, 63, 176, 228
Psp6I CCWGG 1 cut(s) 183
PspFI CCCAGC 1 cut(s) 177
PspGI CCWGG 1 cut(s) 183
PspN4I GGNNCC 1 cut(s) 182
PspPI GGNCC 1 cut(s) 181
RseI CAYNNNNRTG 1 cut(s) 18
SapI GCTCTTC 1 cut(s) 38
SaqAI TTAA 1 cut(s) 2
SatI GCNGC 4 cut(s) 26, 62, 175, 227
Sau3AI GATC 1 cut(s) 126
Sau96I GGNCC 1 cut(s) 181
ScrFI CCNGG 1 cut(s) 185
SetI ASST 2 cut(s) 134, 176
SinI GGWCC 1 cut(s) 181
SmiMI CAYNNNNRTG 1 cut(s) 18
Sse9I AATT 2 cut(s) 84, 207
StyD4I CCNGG 1 cut(s) 183
TasI AATT 2 cut(s) 84, 207
TfiI GAWTC 1 cut(s) 199
Tru1I TTAA 1 cut(s) 2
Tru9I TTAA 1 cut(s) 2
TseI GCWGC 4 cut(s) 25, 61, 174, 226
TspDTI ATGAA 1 cut(s) 181
VpaK11BI GGWCC 1 cut(s) 181
XapI RAATTY 2 cut(s) 84, 207
XcmI CCANNNNNNNNNTGG 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.