Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8032094.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 365

Gene Structure 365 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8032094.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 281 bp

atgagtaacctgaacaaattggactttgctccattaggaacaactggctctagatatcacaggtgggttcgtgatctctgccagcatctcaaggtcgatggaatcttgcatatgattctcgagcctagccaggacgtgctgactgttgagcaagctcaagctttggaagcaaatagagcagccttagaggcaaataagatgaaagccatcatcctaatgactcgtcatatggatgatacgctccaatatgagtgtatgaatgaagaagaccccagaaggct

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000981 GO:0000988 GO:0000989 GO:0001067 GO:0001076 GO:0001134 GO:0001135 GO:0003674 GO:0003676 GO:0003677 GO:0003700 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006355 GO:0006357 GO:0006950 GO:0008150 GO:0009266 GO:0009409 GO:0009628 GO:0009889 GO:0009891 GO:0009893 GO:0009987 GO:0010468 GO:0010556 GO:0010557 GO:0010604 GO:0010628 GO:0019219 GO:0019222 GO:0030154 GO:0031323 GO:0031325 GO:0031326 GO:0031328 GO:0032502 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043565 GO:0044212 GO:0044424 GO:0044464 GO:0045893 GO:0045935 GO:0048518 GO:0048522 GO:0048869 GO:0050789 GO:0050794 GO:0050896 GO:0051171 GO:0051173 GO:0051252 GO:0051254 GO:0060255 GO:0065007 GO:0080090 GO:0097159 GO:0140110 GO:1901363 GO:1902680 GO:1903506 GO:1903508 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Myb_DNA-binding

Protein Analysis

94

Amino Acids

10.86

Weight (kDa)

5.73

Isoelectric Point (pI)

61.6

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AjiI	CACGTC	1 cut(s)	136
AjnI	CCWGG	1 cut(s)	129
AluBI	AGCT	2 cut(s)	155, 161
AluI	AGCT	2 cut(s)	155, 161
Ama87I	CYCGRG	1 cut(s)	119
ApeKI	GCWGC	1 cut(s)	179
AvaI	CYCGRG	1 cut(s)	119
BbsI	GAAGAC	1 cut(s)	273
BbvI	GCAGC	1 cut(s)	191
BccI	CCATC	2 cut(s)	92, 215
BciT130I	CCWGG	1 cut(s)	131
BfaI	CTAG	2 cut(s)	51, 126
BglI	GCCNNNNNGGC	1 cut(s)	188
BisI	GCNGC	1 cut(s)	180
BlsI	GCNGC	1 cut(s)	181
Bme1390I	CCNGG	1 cut(s)	131
BmeT110I	CYCGRG	1 cut(s)	119
BmgBI	CACGTC	1 cut(s)	136
BmrFI	CCNGG	1 cut(s)	131
BmsI	GCATC	1 cut(s)	94
BpiI	GAAGAC	1 cut(s)	273
BpuEI	CTTGAG	2 cut(s)	74, 141
Bse1I	ACTGG	1 cut(s)	49
BseBI	CCWGG	1 cut(s)	131
BseGI	GGATG	2 cut(s)	210, 238
BseNI	ACTGG	1 cut(s)	49
BseXI	GCAGC	1 cut(s)	191
BsiHKCI	CYCGRG	1 cut(s)	119
BsoBI	CYCGRG	1 cut(s)	119
Bsp143I	GATC	1 cut(s)	73
BsrI	ACTGG	1 cut(s)	49
BssMI	GATC	1 cut(s)	73
Bst2UI	CCWGG	1 cut(s)	131
Bst4CI	ACNGT	1 cut(s)	145
BstC8I	GCNNGC	2 cut(s)	83, 153
BstDEI	CTNAG	1 cut(s)	184
BstF5I	GGATG	2 cut(s)	210, 238
BstKTI	GATC	1 cut(s)	76
BstMBI	GATC	1 cut(s)	73
BstMWI	GCNNNNNNNGC	3 cut(s)	167, 176, 188
BstNI	CCWGG	1 cut(s)	131
BstSCI	CCNGG	1 cut(s)	129
BstV1I	GCAGC	1 cut(s)	191
BstV2I	GAAGAC	1 cut(s)	273
BtrI	CACGTC	1 cut(s)	136
BtsCI	GGATG	2 cut(s)	210, 238
Cac8I	GCNNGC	2 cut(s)	83, 153
CviJI	RGCY	8 cut(s)	48, 124, 129, 155, 161, 182, 206, 280
CviKI_1	RGCY	8 cut(s)	48, 124, 129, 155, 161, 182, 206, 280
DdeI	CTNAG	1 cut(s)	184
DpnI	GATC	1 cut(s)	75
DpnII	GATC	1 cut(s)	73
Eco32I	GATATC	1 cut(s)	56
Eco88I	CYCGRG	1 cut(s)	119
EcoRII	CCWGG	1 cut(s)	129
EcoRV	GATATC	1 cut(s)	56
FaiI	YATR	6 cut(s)	111, 113, 228, 230, 249, 257
FauNDI	CATATG	2 cut(s)	111, 228
Fnu4HI	GCNGC	1 cut(s)	180
FokI	GGATG	2 cut(s)	197, 245
Fsp4HI	GCNGC	1 cut(s)	180
FspBI	CTAG	2 cut(s)	51, 126
GluI	GCNGC	1 cut(s)	180
HindIII	AAGCTT	1 cut(s)	159
HinfI	GANTC	3 cut(s)	102, 115, 220
Hpy188III	TCNNGA	3 cut(s)	51, 71, 119
HpyAV	CCTTC	1 cut(s)	270
HpyCH4III	ACNGT	1 cut(s)	145
HpyCH4IV	ACGT	1 cut(s)	135
HpyCH4V	TGCA	1 cut(s)	109
HpyF10VI	GCNNNNNNNGC	3 cut(s)	167, 176, 188
HpyF3I	CTNAG	1 cut(s)	184
HpySE526I	ACGT	1 cut(s)	135
Kzo9I	GATC	1 cut(s)	73
LmnI	GCTCC	2 cut(s)	34, 246
LpnPI	CCDG	6 cut(s)	23, 30, 46, 95, 116, 143
Lsp1109I	GCAGC	1 cut(s)	191
LweI	GCATC	1 cut(s)	94
MaeI	CTAG	2 cut(s)	51, 126
MaeII	ACGT	1 cut(s)	135
MaeIII	GTNAC	1 cut(s)	5
MalI	GATC	1 cut(s)	75
MboI	GATC	1 cut(s)	73
MboII	GAAGA	2 cut(s)	275, 278
MluCI	AATT	1 cut(s)	17
MlyI	GAGTC	1 cut(s)	214
MnlI	CCTC	1 cut(s)	181
MslI	CAYNNNNRTG	2 cut(s)	215, 231
MspR9I	CCNGG	1 cut(s)	131
MvaI	CCWGG	1 cut(s)	131
MwoI	GCNNNNNNNGC	3 cut(s)	167, 176, 188
NdeI	CATATG	2 cut(s)	111, 228
NdeII	GATC	1 cut(s)	73
PaeR7I	CTCGAG	1 cut(s)	119
PfeI	GAWTC	2 cut(s)	102, 115
PkrI	GCNGC	1 cut(s)	181
PleI	GAGTC	1 cut(s)	214
PpsI	GAGTC	1 cut(s)	214
Psp6I	CCWGG	1 cut(s)	129
PspGI	CCWGG	1 cut(s)	129
RseI	CAYNNNNRTG	2 cut(s)	215, 231
SatI	GCNGC	1 cut(s)	180
Sau3AI	GATC	1 cut(s)	73
SchI	GAGTC	1 cut(s)	214
ScrFI	CCNGG	1 cut(s)	131
SetI	ASST	6 cut(s)	12, 65, 96, 138, 157, 163
SfaNI	GCATC	1 cut(s)	94
Sfr274I	CTCGAG	1 cut(s)	119
SlaI	CTCGAG	1 cut(s)	119
SmiMI	CAYNNNNRTG	2 cut(s)	215, 231
SmlI	CTYRAG	3 cut(s)	89, 119, 156
SmoI	CTYRAG	3 cut(s)	89, 119, 156
Sse9I	AATT	1 cut(s)	17
SspMI	CTAG	2 cut(s)	51, 126
StyD4I	CCNGG	1 cut(s)	129
TaaI	ACNGT	1 cut(s)	145
TaiI	ACGT	1 cut(s)	138
TaqI	TCGA	2 cut(s)	96, 120
TasI	AATT	1 cut(s)	17
TfiI	GAWTC	2 cut(s)	102, 115
TseI	GCWGC	1 cut(s)	179
TspDTI	ATGAA	3 cut(s)	215, 272, 276
XbaI	TCTAGA	1 cut(s)	50
XhoI	CTCGAG	1 cut(s)	119
XspI	CTAG	2 cut(s)	51, 126

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.