RLG00000018574
MYB Family

SANT SWI3, ADA2, N-CoR and TFIIIB'' DNA-binding domains

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr4
N/A
Physical Location & Seq
Forward (+)
32073394 .. 32074111
718 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000018574

Sequence Viewer

Length: 615 bp
ATGGAGGCTGTCAATGTAGAAGATGGTAAAAAACGGAACAAAAAGAAGGCCAAATCAGAGAAAGCTGTCAATGTAGAAGATGGTGAAAAAAGGAGGAAGAACTCCAAATCAGAGAGACATATTAATGTAGATGATGACAATAGAGACGCGGAGGCTGTCAATGTAGAAGATGGTAAAAAAAGAAAGAAGAAGAAGAAGAGGGTCAAGTCAGAAAAGCATGTTAATATAGAGGATAGAGACAAAGACGTGGAGGCTGTCAATAAGAAGAAGAAGAAGAAGGCCAAGGCAGAAAAACATGTTCATGTAGAGGATTGCAATAGGAACACAGAGGCTATTATTGTAGAAGATAGTGAAACAAAGAAGAACCCCAGTGATGTGGAGGTCTCACAGTCTGATGGCCCAAGTGATGAGCATCAAGGTCCACTAAGAGATAAACGGTTTACAAAAGAAGGCAAAATTCTTAGAGAGGCTGTATTAAGATGCATAGACGAACCTGGCTTAGGGGGCGACGGCCTCAACATGGTCCTCCATTATAGATCCCACCCTGAAGTAGTTGGTGGTTGGAAGGTAATTGGGGAAGCCATACCTTGGAGGCCTTACAGGAGTGTATATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_6 Myb_DNA-binding

Protein Analysis

205

Amino Acids

23.32

Weight (kDa)

9.34

Isoelectric Point (pI)

53.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 588
AccII CGCG 1 cut(s) 149
AciI CCGC 1 cut(s) 149
AclWI GGATC 1 cut(s) 531
AcsI RAATTY 1 cut(s) 456
AcuI CTGAAG 1 cut(s) 567
AfiI CCNNNNNNNGG 3 cut(s) 500, 520, 588
AflIII ACRYGT 1 cut(s) 295
AjiI CACGTC 1 cut(s) 247
AjnI CCWGG 1 cut(s) 493
AluBI AGCT 1 cut(s) 65
AluI AGCT 1 cut(s) 65
Alw26I GTCTC 4 cut(s) 109, 138, 231, 388
AlwI GGATC 1 cut(s) 531
AoxI GGCC 5 cut(s) 48, 279, 397, 511, 593
ApoI RAATTY 1 cut(s) 456
AseI ATTAAT 1 cut(s) 123
AspS9I GGNCC 3 cut(s) 398, 419, 523
AsuHPI GGTGA 1 cut(s) 95
AvaII GGWCC 2 cut(s) 419, 523
BccI CCATC 4 cut(s) 17, 74, 164, 389
BceAI ACGGC 1 cut(s) 526
BciT130I CCWGG 1 cut(s) 495
BcoDI GTCTC 4 cut(s) 109, 138, 231, 388
Bme1390I CCNGG 1 cut(s) 495
Bme18I GGWCC 2 cut(s) 419, 523
BmgBI CACGTC 1 cut(s) 247
BmgT120I GGNCC 3 cut(s) 398, 419, 523
BmrFI CCNGG 1 cut(s) 495
BmrI ACTGGG 1 cut(s) 363
BmsI GCATC 2 cut(s) 421, 470
BmuI ACTGGG 1 cut(s) 363
Bpu10I CCTNAGC 1 cut(s) 499
BsaBI GATNNNNATC 1 cut(s) 411
BsaI GGTCTC 1 cut(s) 388
BsaJI CCNNGG 2 cut(s) 282, 587
Bsc4I CCNNNNNNNGG 3 cut(s) 500, 520, 588
Bse1I ACTGG 1 cut(s) 369
Bse8I GATNNNNATC 1 cut(s) 411
BseBI CCWGG 1 cut(s) 495
BseDI CCNNGG 2 cut(s) 282, 587
BseJI GATNNNNATC 1 cut(s) 411
BseLI CCNNNNNNNGG 3 cut(s) 500, 520, 588
BseNI ACTGG 1 cut(s) 369
Bsh1236I CGCG 1 cut(s) 149
BshFI GGCC 5 cut(s) 50, 281, 399, 513, 595
BslI CCNNNNNNNGG 3 cut(s) 500, 520, 588
BsmAI GTCTC 4 cut(s) 109, 138, 231, 388
BsmBI CGTCTC 1 cut(s) 138
BsnI GGCC 5 cut(s) 50, 281, 399, 513, 595
Bso31I GGTCTC 1 cut(s) 388
Bsp143I GATC 1 cut(s) 536
BspACI CCGC 1 cut(s) 149
BspANI GGCC 5 cut(s) 50, 281, 399, 513, 595
BspFNI CGCG 1 cut(s) 149
BspPI GGATC 1 cut(s) 531
BspTNI GGTCTC 1 cut(s) 388
BsrI ACTGG 1 cut(s) 369
BssECI CCNNGG 2 cut(s) 282, 587
BssMI GATC 1 cut(s) 536
BssT1I CCWWGG 2 cut(s) 282, 587
Bst2UI CCWGG 1 cut(s) 495
Bst4CI ACNGT 2 cut(s) 390, 438
Bst6I CTCTTC 1 cut(s) 191
BstDEI CTNAG 3 cut(s) 425, 461, 499
BstENI CCTNNNNNAGG 1 cut(s) 498
BstFNI CGCG 1 cut(s) 149
BstKTI GATC 1 cut(s) 539
BstMAI GTCTC 4 cut(s) 109, 138, 231, 388
BstMBI GATC 1 cut(s) 536
BstMWI GCNNNNNNNGC 1 cut(s) 504
BstNI CCWGG 1 cut(s) 495
BstNSI RCATGY 2 cut(s) 221, 299
BstSCI CCNGG 1 cut(s) 493
BstUI CGCG 1 cut(s) 149
BstX2I RGATCY 1 cut(s) 536
BstXI CCANNNNNNTGG 1 cut(s) 376
BstYI RGATCY 1 cut(s) 536
BsuRI GGCC 5 cut(s) 50, 281, 399, 513, 595
BtrI CACGTC 1 cut(s) 247
BtsIMutI CAGTG 1 cut(s) 376
Cfr13I GGNCC 3 cut(s) 398, 419, 523
CseI GACGC 1 cut(s) 155
CviAII CATG 4 cut(s) 218, 296, 302, 520
DdeI CTNAG 3 cut(s) 425, 461, 499
DpnI GATC 1 cut(s) 538
DpnII GATC 1 cut(s) 536
Eam1104I CTCTTC 1 cut(s) 191
EarI CTCTTC 1 cut(s) 191
Eco130I CCWWGG 2 cut(s) 282, 587
Eco147I AGGCCT 1 cut(s) 595
Eco31I GGTCTC 1 cut(s) 388
Eco47I GGWCC 2 cut(s) 419, 523
Eco57I CTGAAG 1 cut(s) 567
EcoNI CCTNNNNNAGG 1 cut(s) 498
EcoRII CCWGG 1 cut(s) 493
EcoT14I CCWWGG 2 cut(s) 282, 587
EcoT22I ATGCAT 1 cut(s) 485
ErhI CCWWGG 2 cut(s) 282, 587
Esp3I CGTCTC 1 cut(s) 138
FaeI CATG 4 cut(s) 221, 299, 305, 523
FatI CATG 4 cut(s) 217, 295, 301, 519
HaeIII GGCC 5 cut(s) 50, 281, 399, 513, 595
HgaI GACGC 1 cut(s) 155
Hin1II CATG 4 cut(s) 221, 299, 305, 523
HphI GGTGA 1 cut(s) 95
Hpy166II GTNNAC 2 cut(s) 422, 441
Hpy188I TCNGA 4 cut(s) 58, 112, 211, 394
Hpy8I GTNNAC 2 cut(s) 422, 441
Hpy99I CGWCG 1 cut(s) 512
HpyAV CCTTC 4 cut(s) 40, 271, 443, 559
HpyCH4III ACNGT 2 cut(s) 390, 438
HpyCH4IV ACGT 1 cut(s) 246
HpyCH4V TGCA 2 cut(s) 315, 483
HpyF10VI GCNNNNNNNGC 1 cut(s) 504
HpyF3I CTNAG 3 cut(s) 425, 461, 499
HpySE526I ACGT 1 cut(s) 246
Hsp92II CATG 4 cut(s) 221, 299, 305, 523
Kzo9I GATC 1 cut(s) 536
LpnPI CCDG 5 cut(s) 382, 480, 507, 558, 586
LweI GCATC 2 cut(s) 421, 470
MaeII ACGT 1 cut(s) 246
MalI GATC 1 cut(s) 538
MboI GATC 1 cut(s) 536
MflI RGATCY 1 cut(s) 536
MluCI AATT 2 cut(s) 456, 570
MmeI TCCRAC 1 cut(s) 542
Mph1103I ATGCAT 1 cut(s) 485
MseI TTAA 3 cut(s) 123, 222, 476
MslI CAYNNNNRTG 2 cut(s) 123, 300
MspR9I CCNGG 1 cut(s) 495
MvaI CCWGG 1 cut(s) 495
MvnI CGCG 1 cut(s) 149
MwoI GCNNNNNNNGC 1 cut(s) 504
NdeII GATC 1 cut(s) 536
NlaIII CATG 4 cut(s) 221, 299, 305, 523
NsiI ATGCAT 1 cut(s) 485
NspI RCATGY 2 cut(s) 221, 299
PceI AGGCCT 1 cut(s) 595
PciI ACATGT 1 cut(s) 295
PflMI CCANNNNNTGG 1 cut(s) 588
PscI ACATGT 1 cut(s) 295
PshBI ATTAAT 1 cut(s) 123
Psp6I CCWGG 1 cut(s) 493
PspGI CCWGG 1 cut(s) 493
PspPI GGNCC 3 cut(s) 398, 419, 523
PsuI RGATCY 1 cut(s) 536
RseI CAYNNNNRTG 2 cut(s) 123, 300
SaqAI TTAA 3 cut(s) 123, 222, 476
Sau3AI GATC 1 cut(s) 536
Sau96I GGNCC 3 cut(s) 398, 419, 523
ScrFI CCNGG 1 cut(s) 495
SetI ASST 7 cut(s) 67, 249, 384, 421, 496, 570, 589
SfaNI GCATC 2 cut(s) 421, 470
SinI GGWCC 2 cut(s) 419, 523
SmiMI CAYNNNNRTG 2 cut(s) 123, 300
Sse9I AATT 2 cut(s) 456, 570
SseBI AGGCCT 1 cut(s) 595
SsiI CCGC 1 cut(s) 149
StuI AGGCCT 1 cut(s) 595
StyD4I CCNGG 1 cut(s) 493
StyI CCWWGG 2 cut(s) 282, 587
TaaI ACNGT 2 cut(s) 390, 438
TaiI ACGT 1 cut(s) 249
TasI AATT 2 cut(s) 456, 570
Tru1I TTAA 3 cut(s) 123, 222, 476
Tru9I TTAA 3 cut(s) 123, 222, 476
TscAI CASTG 1 cut(s) 376
TspDTI ATGAA 1 cut(s) 290
TspGWI ACGGA 1 cut(s) 49
TspRI CASTG 1 cut(s) 376
Van91I CCANNNNNTGG 1 cut(s) 588
VpaK11BI GGWCC 2 cut(s) 419, 523
VspI ATTAAT 1 cut(s) 123
XagI CCTNNNNNAGG 1 cut(s) 498
XapI RAATTY 1 cut(s) 456
XceI RCATGY 2 cut(s) 221, 299
Zsp2I ATGCAT 1 cut(s) 485
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.